Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3681
Trapped Gene
RP23-166A1.1 (ENSMUSG00000078901)
Vector Insertion
Chr 2: 175100705 - 175108798
Public Clones XR0167 (sanger) RRI488 (baygenomics)
Private Clones OST66754 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000678885 (Chr2:175100626..175100704 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTGATGTGTTCTGCGTGAC Chr2:175100634..175100653 59.27 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000678885 (Chr2:175100626..175100704 +)
Downstram Exon
ENSMUSE00000678884 (Chr2:175108799..175108925 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTGATGTGTTCTGCGTGAC Chr2:175100634..175100653 59.27 50 TCTGAGAAGCATCCAGCAAA Chr2:175108874..175108893 59.67 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000678885 Chr2:175100626..175100704 TGTGATGTGTTCTGCGTGAC Chr2:175100634..175100653 59.27 50

*** Putative Vector Insertion (Chr 2: 175100705 - 175108798) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000678884 Chr2:175108799..175108925 TCTGAGAAGCATCCAGCAAA Chr2:175108874..175108893 59.67 45
downstream ENSMUSE00000638700 Chr2:175109131..175109191 No primer for this exon
downstream ENSMUSE00000678883 Chr2:175109131..175112306 TTGGCACACGTGAAATTGTT Chr2:175110335..175110354 60.01 40
downstream ENSMUSE00000678882 Chr2:175112418..175112466 CTTGGCAGTATGGATTGTTTCA Chr2:175112451..175112472 60 40.91

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGGTGTTGTGAGAGGAGGT Chr2:175100660..175100680 60.56 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGTGTTGTGAGAGGAGGT Chr2:175100660..175100680 60.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078901