Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36814
Trapped Gene
EG545758 (ENSMUSG00000060204)
Vector Insertion
Chr 5: 72972877 - 72977658
Public Clones IST10348A9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 39% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000503783 (Chr5:72977445..72977657 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCTGGATCAATACCCCTCT Chr5:72977563..72977582 60.29 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000503783 (Chr5:72977445..72977657 -)
Downstram Exon
ENSMUSE00000379450 (Chr5:72972878..72973958 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCTGGATCAATACCCCTCT Chr5:72977563..72977582 60.29 55 CACTGACCCGTTTTGGACTT Chr5:72973018..72973037 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000598557 Chr5:72978704..72978789 GACGCTTGACCAGACAGACA Chr5:72978705..72978724 60.03 55
upstream ENSMUSE00000503783 Chr5:72977445..72977657 GCCTGGATCAATACCCCTCT Chr5:72977563..72977582 60.29 55
upstream ENSMUSE00000379450 Chr5:72972878..72973958 AAGTCCAAAACGGGTCAGTG Chr5:72973040..72973059 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTCAGTAATCGCCTTGCAG Chr5:72977593..72977613 59.06 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGTTGAGATGCCGTGACTG Chr5:72977599..72977619 60.32 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000060204