Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3682
Trapped Gene
Prkcbp1 (ENSMUSG00000039671)
Vector Insertion
Chr 2: 165701276 - 165701784
Public Clones (sanger) XP0236 (sanger) FHCRC-GT-S21-9H1 (fhcrc) FHCRC-GT-S6-11F1 (fhcrc)
FHCRC-GT-S16-6E1 (fhcrc) FHCRC-GT-S7-2A1 (fhcrc) FHCRC-GT-S17-3D1 (fhcrc)
FHCRC-GT-S6-10D1 (fhcrc) FHCRC-GT-S11-6D1 (fhcrc) FHCRC-GT-S7-10E1 (fhcrc)
FHCRC-GT-S17-11F1 (fhcrc) FHCRC-GT-S2-1C1 (fhcrc) FHCRC-GT-S9-4F1 (fhcrc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000679682 (Chr2:165701785..165703937 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCCATGTTGGTGACATGCT Chr2:165702709..165702728 59.97 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000679682 (Chr2:165701785..165703937 -)
Downstram Exon
ENSMUSE00000717447 (Chr2:165701205..165701275 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCCATGTTGGTGACATGCT Chr2:165702709..165702728 59.97 45 CACCTCCTGCTCGGTTTTTA Chr2:165701217..165701236 60.24 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000679658 Chr2:165724416..165724462 No primer for this exon
upstream ENSMUSE00000679660 Chr2:165722353..165722450 AGAGAATGCTGGGTTCTGGA Chr2:165722392..165722411 59.8 50
upstream ENSMUSE00000592815 Chr2:165710108..165710145 No primer for this exon
upstream ENSMUSE00000679676 Chr2:165710108..165710374 CCCGAGCCTCACAAAGATAA Chr2:165710304..165710323 60.21 50
upstream ENSMUSE00000679684 Chr2:165710108..165710272 CAATCGGGGATGAGCTTTTA Chr2:165710223..165710242 60.03 45
upstream ENSMUSE00000679637 Chr2:165709679..165709710 CTGGGGGAAGAAAATGGAAG Chr2:165709679..165709698 60.79 50
upstream ENSMUSE00000679683 Chr2:165708828..165708898 No primer for this exon
upstream ENSMUSE00000679694 Chr2:165707649..165707778 CACGCATTAAAATGGCTCCT Chr2:165707754..165707773 60.1 45
upstream ENSMUSE00000679682 Chr2:165701785..165703937 TTCCATGTTGGTGACATGCT Chr2:165702709..165702728 59.97 45

*** Putative Vector Insertion (Chr 2: 165701276 - 165701784) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000409419 Chr2:165701205..165701275 CACCTCCTGCTCGGTTTTTA Chr2:165701217..165701236 60.24 50
downstream ENSMUSE00000550359 Chr2:165701205..165701275 CACCTCCTGCTCGGTTTTTA Chr2:165701217..165701236 60.24 50
downstream ENSMUSE00000717447 Chr2:165701205..165701275 CACCTCCTGCTCGGTTTTTA Chr2:165701217..165701236 60.24 50
downstream ENSMUSE00000679677 Chr2:165678368..165678383 No primer for this exon
downstream ENSMUSE00000679681 Chr2:165678368..165678379 No primer for this exon
downstream ENSMUSE00000679636 Chr2:165677533..165677648 TCTTTTTAATGGGGCTCGTG Chr2:165677519..165677538 60.07 45
downstream ENSMUSE00000592814 Chr2:165677500..165677648 TCTTTTTAATGGGGCTCGTG Chr2:165677519..165677538 60.07 45
downstream ENSMUSE00000550346 Chr2:165671521..165671739 GTCCTGCGGTACAACATCAA Chr2:165671640..165671659 59.57 50
downstream ENSMUSE00000679691 Chr2:165671521..165671664 CTCTGGCTCCGATGTCAGTC Chr2:165671526..165671545 60.98 60
downstream ENSMUSE00000639167 Chr2:165668264..165668377 CGTCTCGATGCATTCTGCTA Chr2:165668326..165668345 60.12 50
downstream ENSMUSE00000710025 Chr2:165665498..165665590 AGTCAGGGTGTTGCTCCAAT Chr2:165665523..165665542 59.58 50
downstream ENSMUSE00000717483 Chr2:165665498..165665590 AGTCAGGGTGTTGCTCCAAT Chr2:165665523..165665542 59.58 50
downstream ENSMUSE00000639165 Chr2:165664312..165664399 CTTCTGTGCAGCCGTACATC Chr2:165664344..165664363 59.47 55
downstream ENSMUSE00000679656 Chr2:165664312..165664399 CTTCTGTGCAGCCGTACATC Chr2:165664344..165664363 59.47 55
downstream ENSMUSE00000639163 Chr2:165662781..165662836 TGCTATTTGCGTCAACTTGTG Chr2:165662789..165662809 59.93 42.86
downstream ENSMUSE00000679655 Chr2:165662781..165662836 TGCTATTTGCGTCAACTTGTG Chr2:165662789..165662809 59.93 42.86
downstream ENSMUSE00000639162 Chr2:165660390..165660467 TTTTGGCAAGCTGCAAGATA Chr2:165660396..165660415 59.58 40
downstream ENSMUSE00000679654 Chr2:165660390..165660467 TTTTGGCAAGCTGCAAGATA Chr2:165660396..165660415 59.58 40
downstream ENSMUSE00000639161 Chr2:165658809..165658924 CCTTTCAGTTTTGCCCAGAC Chr2:165658865..165658884 59.71 50
downstream ENSMUSE00000679653 Chr2:165658809..165658924 CCTTTCAGTTTTGCCCAGAC Chr2:165658865..165658884 59.71 50
downstream ENSMUSE00000520710 Chr2:165653708..165654189 TACTGGTTGTTGGGCGTGTA Chr2:165653982..165654001 60.03 50
downstream ENSMUSE00000639160 Chr2:165653708..165654189 TACTGGTTGTTGGGCGTGTA Chr2:165653982..165654001 60.03 50
downstream ENSMUSE00000679659 Chr2:165652682..165654189 AGTTACGGTCGCCATGGTAG Chr2:165652972..165652991 60.01 55
downstream ENSMUSE00000639159 Chr2:165646042..165646188 TGGAAGTCTTGTCGGGTTTT Chr2:165646056..165646075 59.57 45
downstream ENSMUSE00000679651 Chr2:165646042..165646188 TGGAAGTCTTGTCGGGTTTT Chr2:165646056..165646075 59.57 45
downstream ENSMUSE00000639158 Chr2:165640817..165640969 GACTCGCTCAGCTCCTTCAG Chr2:165640905..165640924 60.43 60
downstream ENSMUSE00000679649 Chr2:165640817..165640969 GACTCGCTCAGCTCCTTCAG Chr2:165640905..165640924 60.43 60
downstream ENSMUSE00000596214 Chr2:165637849..165638358 CACTGTGGGAGAATCCGTTT Chr2:165637948..165637967 59.97 50
downstream ENSMUSE00000639157 Chr2:165637849..165638358 CACTGTGGGAGAATCCGTTT Chr2:165637948..165637967 59.97 50
downstream ENSMUSE00000592802 Chr2:165633175..165633429 ACGGTAGACATCGTGCTGGT Chr2:165633266..165633285 60.6 55
downstream ENSMUSE00000550279 Chr2:165633019..165633429 ACTTTTGGGAGGACGTTTGA Chr2:165633126..165633145 59.57 45
downstream ENSMUSE00000679647 Chr2:165633019..165633429 ACTTTTGGGAGGACGTTTGA Chr2:165633126..165633145 59.57 45
downstream ENSMUSE00000639156 Chr2:165630687..165630877 CTCTGGGTGACCTCCTTCTG Chr2:165630828..165630847 59.83 60
downstream ENSMUSE00000679646 Chr2:165630687..165630877 CTCTGGGTGACCTCCTTCTG Chr2:165630828..165630847 59.83 60
downstream ENSMUSE00000635218 Chr2:165623434..165623514 GCTATTGTGCTCCCAGTGGT Chr2:165623416..165623435 60.14 55
downstream ENSMUSE00000639155 Chr2:165623434..165623514 GCTATTGTGCTCCCAGTGGT Chr2:165623416..165623435 60.14 55
downstream ENSMUSE00000639154 Chr2:165621583..165621661 ATCTCAATCCTCAGCCTTCG Chr2:165621617..165621636 59.39 50
downstream ENSMUSE00000679643 Chr2:165621583..165621661 ATCTCAATCCTCAGCCTTCG Chr2:165621617..165621636 59.39 50
downstream ENSMUSE00000635216 Chr2:165619895..165620134 CCAGCTCCAGTTGCTTTTTC Chr2:165620029..165620048 59.99 50
downstream ENSMUSE00000639153 Chr2:165619895..165620134 CCAGCTCCAGTTGCTTTTTC Chr2:165620029..165620048 59.99 50
downstream ENSMUSE00000679674 Chr2:165618312..165618467 GTTGCCCTGCGATGACTTAT Chr2:165618375..165618394 60.1 50
downstream ENSMUSE00000639152 Chr2:165618304..165618467 GTTGCCCTGCGATGACTTAT Chr2:165618375..165618394 60.1 50
downstream ENSMUSE00000679641 Chr2:165618304..165618467 GTTGCCCTGCGATGACTTAT Chr2:165618375..165618394 60.1 50
downstream ENSMUSE00000639151 Chr2:165617405..165617471 No primer for this exon
downstream ENSMUSE00000679640 Chr2:165617405..165617471 No primer for this exon
downstream ENSMUSE00000679672 Chr2:165617405..165617471 No primer for this exon
downstream ENSMUSE00000639150 Chr2:165612664..165612747 GGCTGGTGGTCTGTAGTGGT Chr2:165612668..165612687 60.03 60
downstream ENSMUSE00000679639 Chr2:165612664..165612747 GGCTGGTGGTCTGTAGTGGT Chr2:165612668..165612687 60.03 60
downstream ENSMUSE00000639147 Chr2:165611019..165611238 GCTCACAATGCACCCCTAGT Chr2:165611053..165611072 60.14 55
downstream ENSMUSE00000679638 Chr2:165610811..165611238 GCTCACAATGCACCCCTAGT Chr2:165611053..165611072 60.14 55
downstream ENSMUSE00000706073 Chr2:165610811..165611238 GCTCACAATGCACCCCTAGT Chr2:165611053..165611072 60.14 55
downstream ENSMUSE00000679680 Chr2:165610809..165611238 GCTCACAATGCACCCCTAGT Chr2:165611053..165611072 60.14 55
downstream ENSMUSE00000420365 Chr2:165610782..165611238 GCTCACAATGCACCCCTAGT Chr2:165611053..165611072 60.14 55
downstream ENSMUSE00000639169 Chr2:165609655..165611238 GGGCCTACGTGAAAATAGCA Chr2:165610625..165610644 60.1 50
downstream ENSMUSE00000639168 Chr2:165609654..165611238 GGGCCTACGTGAAAATAGCA Chr2:165610625..165610644 60.1 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCATGTTCCTGACTCACTGG Chr2:165701739..165701759 59.1 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGCTCGTGACTGGGAAAAC Chr2:165701718..165701738 59.85 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTTTCTCCAGCTGCAGTTTTC Chr2:165703909..165703930 59.62 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTGTTATTTGGCCGTGACTG Chr2:165703879..165703899 59.58 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039671