Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36831
Trapped Gene
Pigyl (ENSMUSG00000010607)
Vector Insertion
Chr 9: 21961358 - 21962175
Public Clones IST13209F7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000217913 (Chr9:21961310..21961357 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGGGACCGGACTCCTACAG Chr9:21961327..21961346 60.5 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000217913 (Chr9:21961310..21961357 +)
Downstram Exon
ENSMUSE00000217912 (Chr9:21962176..21962776 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGGGACCGGACTCCTACAG Chr9:21961327..21961346 60.5 60 GGGTGCGCTCTTGTCTTATC Chr9:21962372..21962391 59.84 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000217913 Chr9:21961310..21961357 AAGGGACCGGACTCCTACAG Chr9:21961327..21961346 60.5 60

*** Putative Vector Insertion (Chr 9: 21961358 - 21962175) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000217912 Chr9:21962176..21962776 GGGTGCGCTCTTGTCTTATC Chr9:21962372..21962391 59.84 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTGAAACCGGCTGTAATCG Chr9:21961395..21961415 60.5 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTCCTACAGGCCTGCAAAC Chr9:21961338..21961358 59.36 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000010607