Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36832
Trapped Gene
Pglyrp2 (ENSMUSG00000079563)
Vector Insertion
Chr 17: 32557744 - 32561113
Public Clones IST14642D4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000699436 (Chr17:32560943..32561112 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGTACCCTGAGCCTTCGTT Chr17:32561065..32561084 60.13 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000699436 (Chr17:32560943..32561112 -)
Downstram Exon
ENSMUSE00000699435 (Chr17:32557745..32557858 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGTACCCTGAGCCTTCGTT Chr17:32561065..32561084 60.13 55 AATCCAAGCACGATCCAGAG Chr17:32557749..32557768 60.22 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000699436 Chr17:32560943..32561112 AGGTACCCTGAGCCTTCGTT Chr17:32561065..32561084 60.13 55
upstream ENSMUSE00000699435 Chr17:32557745..32557858 CTCTGGATCGTGCTTGGATT Chr17:32557771..32557790 60.22 50

*** Putative Vector Insertion (Chr 17: 32557744 - 32561113) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000699427 Chr17:32555053..32555933 TAGGGATTTGGCTCAAGTGG Chr17:32555165..32555184 60.07 50
downstream ENSMUSE00000699432 Chr17:32554926..32555933 TAGGGATTTGGCTCAAGTGG Chr17:32555165..32555184 60.07 50
downstream ENSMUSE00000699431 Chr17:32553823..32554033 GTAGCCGATGTCATCCCACT Chr17:32553803..32553822 59.96 55
downstream ENSMUSE00000699426 Chr17:32552751..32553048 AGTGTAGTTGCCCACGAAGG Chr17:32552909..32552928 60.17 55
downstream ENSMUSE00000699429 Chr17:32552751..32553048 AGTGTAGTTGCCCACGAAGG Chr17:32552909..32552928 60.17 55
downstream ENSMUSE00000699425 Chr17:32550306..32550419 TGTGGTTGCTCAAAGGATCA Chr17:32550319..32550338 60.24 45
downstream ENSMUSE00000699428 Chr17:32550306..32550419 TGTGGTTGCTCAAAGGATCA Chr17:32550319..32550338 60.24 45
downstream ENSMUSE00000699430 Chr17:32550306..32550419 TGTGGTTGCTCAAAGGATCA Chr17:32550319..32550338 60.24 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGGTACCCTGAGCCTTCGT Chr17:32561064..32561084 60.13 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGGTACCCTGAGCCTTCGT Chr17:32561064..32561084 60.13 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079563