Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36833
Trapped Gene
4930528G09Rik (ENSMUSG00000064280)
Vector Insertion
Chr 5: 20838837 - 20905668
Public Clones IST14642D4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 20% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000715757 (Chr5:20905435..20905667 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGCGGCTCATCAATTTAGC Chr5:20905466..20905485 59.95 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000715757 (Chr5:20905435..20905667 -)
Downstram Exon
ENSMUSE00000474903 (Chr5:20838838..20838920 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGCGGCTCATCAATTTAGC Chr5:20905466..20905485 59.95 50 AGTTTTCCCTTGGAGTGCAG Chr5:20838879..20838898 59.33 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000466893 Chr5:20930383..20930495 GGACCAAAACACACGGAGAA Chr5:20930422..20930441 60.93 50
upstream ENSMUSE00000465928 Chr5:20905435..20905667 GAGCGGCTCATCAATTTAGC Chr5:20905466..20905485 59.95 50
upstream ENSMUSE00000715757 Chr5:20905435..20905667 GAGCGGCTCATCAATTTAGC Chr5:20905466..20905485 59.95 50
upstream ENSMUSE00000474903 Chr5:20838838..20838920 GGCAGAGTTGAAAGCCAAGT Chr5:20838866..20838885 59.48 50

*** Putative Vector Insertion (Chr 5: 20838837 - 20905668) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000470039 Chr5:20836358..20836567 TGCAGACCTCAGTGGTGAAG Chr5:20836421..20836440 60.02 55
downstream ENSMUSE00000469023 Chr5:20828562..20828619 No primer for this exon
downstream ENSMUSE00000181966 Chr5:20826982..20827158 TTCTGCTTGAGCACCACATC Chr5:20827021..20827040 59.99 50
downstream ENSMUSE00000181971 Chr5:20825347..20825420 No primer for this exon
downstream ENSMUSE00000602900 Chr5:20823804..20824031 GCAGTTGGCCATACTCTCGT Chr5:20823834..20823853 60.28 55
downstream ENSMUSE00000374576 Chr5:20823650..20824031 GCAGTTGGCCATACTCTCGT Chr5:20823834..20823853 60.28 55
downstream ENSMUSE00000602899 Chr5:20822604..20822790 GCCTTTGATTCATGGCTTGT Chr5:20822593..20822612 60.08 45
downstream ENSMUSE00000602898 Chr5:20815411..20815506 GGAGCTCTTTCCTTCGTTCA Chr5:20815430..20815449 59.55 50
downstream ENSMUSE00000602897 Chr5:20814431..20814601 GCTCCACTAACTTGGCCTCA Chr5:20814543..20814562 60.4 55
downstream ENSMUSE00000602896 Chr5:20811331..20811419 TGATTTCAAGGTCCTTTGATTTG Chr5:20811346..20811368 60.33 34.78
downstream ENSMUSE00000602895 Chr5:20811071..20811235 GCGCTGTTCCTTAAGATTTCC Chr5:20811064..20811084 60.22 47.62
downstream ENSMUSE00000291482 Chr5:20808882..20809106 AGCATGGCGTTTTGTAGCTT Chr5:20809064..20809083 59.91 45
downstream ENSMUSE00000291476 Chr5:20807046..20807274 TGGCACTAGTTTCCGTGTCA Chr5:20807069..20807088 60.3 50
downstream ENSMUSE00000291470 Chr5:20803367..20803495 CTTGCTGTCAGGGTTCACAA Chr5:20803411..20803430 59.87 50
downstream ENSMUSE00000291466 Chr5:20802752..20802889 AGCCTGAGTTTTGCCTTTGA Chr5:20802763..20802782 59.99 45
downstream ENSMUSE00000291460 Chr5:20800271..20800519 GTTCAATGGTCAGGGCTTGT Chr5:20800404..20800423 59.97 50
downstream ENSMUSE00000331594 Chr5:20799113..20799313 CTTCAGGCATGTAGGCGTTT Chr5:20799207..20799226 60.27 50
downstream ENSMUSE00000702153 Chr5:20798779..20799313 TCAAAATGCCCTTTGACACA Chr5:20798862..20798881 60.09 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGTAATCGCCTTGCAGCAC Chr5:20842600..20842620 61.78 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAACTGACGTGACTGGGAAA Chr5:20842604..20842625 60.14 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000064280