Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36848
Trapped Gene
Rab8a (ENSMUSG00000003037)
Vector Insertion
Chr 8: 74692387 - 74695138
Public Clones IST14848B4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 30% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000213146 (Chr8:74692326..74692386 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000213146 (Chr8:74692326..74692386 +)
Downstram Exon
ENSMUSE00000213153 (Chr8:74695139..74695199 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000607088 Chr8:74685247..74685381 No primer for this exon
upstream ENSMUSE00000213146 Chr8:74692326..74692386 No primer for this exon

*** Putative Vector Insertion (Chr 8: 74692387 - 74695138) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000213153 Chr8:74695139..74695199 No primer for this exon
downstream ENSMUSE00000213148 Chr8:74698425..74698502 No primer for this exon
downstream ENSMUSE00000213151 Chr8:74699739..74699828 No primer for this exon
downstream ENSMUSE00000213152 Chr8:74700222..74700287 No primer for this exon
downstream ENSMUSE00000213147 Chr8:74701519..74701569 No primer for this exon
downstream ENSMUSE00000488178 Chr8:74703944..74704747 No primer for this exon
downstream ENSMUSE00000636054 Chr8:74703944..74703989 No primer for this exon
downstream ENSMUSE00000636052 Chr8:74704540..74704589 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGGACTAATCGCCTTGCAG Chr8:74692432..74692452 60.92 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGTGAGTGCTAGTGCCTTG Chr8:74692386..74692406 60.05 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000003037