Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36854
Trapped Gene
4930420K17Rik (ENSMUSG00000079659)
Vector Insertion
Chr 5: 9101396 - 9116479
Public Clones IST11722H1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 22% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000702609 (Chr5:9101217..9101395 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTTGCTACCAGGACCTACGG Chr5:9101327..9101346 60.12 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000702609 (Chr5:9101217..9101395 +)
Downstram Exon
ENSMUSE00000702608 (Chr5:9116480..9116530 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTTGCTACCAGGACCTACGG Chr5:9101327..9101346 60.12 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000702610 Chr5:9100737..9100859 No primer for this exon
upstream ENSMUSE00000702609 Chr5:9101217..9101395 TTTGCTACCAGGACCTACGG Chr5:9101327..9101346 60.12 55

*** Putative Vector Insertion (Chr 5: 9101396 - 9116479) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000702608 Chr5:9116480..9116530 No primer for this exon
downstream ENSMUSE00000702607 Chr5:9117459..9117563 GGGAGGTAGTTGAGGGAACA Chr5:9117503..9117522 58.99 55
downstream ENSMUSE00000702606 Chr5:9118454..9118983 ACCACACGTCTGTCGATGAG Chr5:9118677..9118696 59.74 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr5:9110446..9110466 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCAGAACGTGACTGGGAAAAC Chr5:9110441..9110462 60.14 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079659