Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36859
Trapped Gene
Leng8 (ENSMUSG00000035545)
Vector Insertion
Chr 7: 4088758 - 4090297
Public Clones IST14653H2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000716087 (Chr7:4088668..4088757 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGCGCTGTCTTGGTTGTCT Chr7:4088684..4088703 60.6 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000716087 (Chr7:4088668..4088757 +)
Downstram Exon
ENSMUSE00000711043 (Chr7:4090298..4090390 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGCGCTGTCTTGGTTGTCT Chr7:4088684..4088703 60.6 55 GACCTTGGGGTGTAGGGAAT Chr7:4090352..4090371 60.05 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000411108 Chr7:4088658..4088753 GAGCGCTGTCTTGGTTGTCT Chr7:4088684..4088703 60.6 55
upstream ENSMUSE00000715319 Chr7:4088662..4088753 GAGCGCTGTCTTGGTTGTCT Chr7:4088684..4088703 60.6 55
upstream ENSMUSE00000716087 Chr7:4088668..4088757 GAGCGCTGTCTTGGTTGTCT Chr7:4088684..4088703 60.6 55

*** Putative Vector Insertion (Chr 7: 4088758 - 4090297) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000367590 Chr7:4090298..4090390 GACCTTGGGGTGTAGGGAAT Chr7:4090352..4090371 60.05 55
downstream ENSMUSE00000711043 Chr7:4090298..4090390 GACCTTGGGGTGTAGGGAAT Chr7:4090352..4090371 60.05 55
downstream ENSMUSE00000306784 Chr7:4091021..4091192 GCTTTGGAACTGCTGGTAGC Chr7:4091164..4091183 60.02 55
downstream ENSMUSE00000306776 Chr7:4091538..4091645 CAGAGGCTTCTGCCTGAGAG Chr7:4091565..4091584 60.42 60
downstream ENSMUSE00000711254 Chr7:4091538..4092054 CTAATGTCCTGGGGTCTGGA Chr7:4091840..4091859 59.92 55
downstream ENSMUSE00000374239 Chr7:4092625..4092735 GCTGTAGCTGAGCCGTAGGA Chr7:4092695..4092714 60.7 60
downstream ENSMUSE00000306767 Chr7:4093634..4093886 GTTTCATGCGGGTCCATAAC Chr7:4093889..4093908 60.2 50
downstream ENSMUSE00000306759 Chr7:4094099..4094240 GAAGCTCTGGCTGGTGACAG Chr7:4094172..4094191 61.15 60
downstream ENSMUSE00000306748 Chr7:4094436..4094639 GCCTGTAGCACCTCCTTGAG Chr7:4094585..4094604 60.01 60
downstream ENSMUSE00000306739 Chr7:4095021..4095299 AGTGTCTCGTGGGAGACCTG Chr7:4095292..4095311 60.31 60
downstream ENSMUSE00000306732 Chr7:4095390..4095530 CCTACAGGGTGGCACTCATT Chr7:4095449..4095468 59.99 55
downstream ENSMUSE00000306725 Chr7:4095655..4095940 TACGTTTGGTGGGAGCTAGG Chr7:4095683..4095702 60.12 55
downstream ENSMUSE00000306828 Chr7:4096314..4096415 TCCTTCCAGTGGGACTTGAC Chr7:4096360..4096379 60.09 55
downstream ENSMUSE00000306821 Chr7:4096497..4096565 GGCATGGGTCTCATACACCT Chr7:4096550..4096569 59.81 55
downstream ENSMUSE00000306816 Chr7:4096657..4096786 CCCACATTGCCTGCTAAGTT Chr7:4096736..4096755 60.13 50
downstream ENSMUSE00000372922 Chr7:4096868..4099775 CCTGACAGTCAAGGCTCCTC Chr7:4097732..4097751 59.99 60
downstream ENSMUSE00000715730 Chr7:4096868..4097075 GAAGAAGCGGTGGTAGTTGC Chr7:4096983..4097002 59.88 55
downstream ENSMUSE00000717014 Chr7:4098543..4099774 CAGCGTTAGTGGAGGTGACA Chr7:4098979..4098998 59.9 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCGGTCCTAGTGAGTGTGG Chr7:4088745..4088765 60.32 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCGGTCCTAGTGAGTGTGG Chr7:4088745..4088765 60.32 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035545