Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36871
Trapped Gene
Athl1 (ENSMUSG00000062031)
Vector Insertion
Chr 7: 148127543 - 148128183
Public Clones IST10407D1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000709516 (Chr7:148127480..148127542 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCACAGAGCCTTCTTACACC Chr7:148127491..148127511 61.05 57.14 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000709516 (Chr7:148127480..148127542 +)
Downstram Exon
ENSMUSE00000512462 (Chr7:148128184..148128464 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCACAGAGCCTTCTTACACC Chr7:148127491..148127511 61.05 57.14 CAGACAACGGGCACTGAATA Chr7:148128259..148128278 59.72 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000709516 Chr7:148127480..148127542 CCCACAGAGCCTTCTTACACC Chr7:148127491..148127511 61.05 57.14
upstream ENSMUSE00000720480 Chr7:148127480..148127542 CCCACAGAGCCTTCTTACACC Chr7:148127491..148127511 61.05 57.14

*** Putative Vector Insertion (Chr 7: 148127543 - 148128183) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000512462 Chr7:148128184..148128464 CAGACAACGGGCACTGAATA Chr7:148128259..148128278 59.72 50
downstream ENSMUSE00000587046 Chr7:148128184..148128464 CAGACAACGGGCACTGAATA Chr7:148128259..148128278 59.72 50
downstream ENSMUSE00000484192 Chr7:148128885..148129095 GAAGACCAGGACATGGGGTA Chr7:148128976..148128995 59.78 55
downstream ENSMUSE00000486100 Chr7:148129176..148129611 CATGGCTGATGAATCCTTGA Chr7:148129543..148129562 59.6 45
downstream ENSMUSE00000587045 Chr7:148129176..148129674 AACCAGTGCAGGGTAGGATG Chr7:148129637..148129656 59.99 55
downstream ENSMUSE00000481117 Chr7:148130544..148130663 CAGCGTACGGACTCGGTATT Chr7:148130627..148130646 60.15 55
downstream ENSMUSE00000482904 Chr7:148130850..148130981 TGGGTCCCATAAATGTCCTC Chr7:148130923..148130942 59.6 50
downstream ENSMUSE00000474028 Chr7:148131137..148131248 CCTGGGAGCTCCATTCTACA Chr7:148131230..148131249 60.21 55
downstream ENSMUSE00000475013 Chr7:148131354..148131426 TGGACCAGGACATTGGTGTA Chr7:148131423..148131442 59.81 50
downstream ENSMUSE00000476066 Chr7:148131525..148131661 GATCCTATCAGCCACCTCCA Chr7:148131606..148131625 60.03 55
downstream ENSMUSE00000668389 Chr7:148131529..148131661 GATCCTATCAGCCACCTCCA Chr7:148131606..148131625 60.03 55
downstream ENSMUSE00000470951 Chr7:148131779..148131912 TTTTTCCTTCGGATGTCAGG Chr7:148131863..148131882 60.04 45
downstream ENSMUSE00000472014 Chr7:148132006..148132101 AGTGACATTGGCGAAACTCC Chr7:148132092..148132111 60.12 50
downstream ENSMUSE00000499518 Chr7:148132230..148132327 CCCATGCCAGTCAAGAAGTT Chr7:148132288..148132307 60.11 50
downstream ENSMUSE00000500545 Chr7:148132401..148132612 GTCACCGAGTCCTTGGAAAA Chr7:148132526..148132545 60.09 50
downstream ENSMUSE00000587043 Chr7:148132420..148132620 GTCACCGAGTCCTTGGAAAA Chr7:148132526..148132545 60.09 50
downstream ENSMUSE00000501570 Chr7:148132688..148133557 AGCTAAGCCCCTGACTGTGA Chr7:148133148..148133167 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGCGGTGAGTTACAAAAA Chr7:148127538..148127558 58.97 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTCTCGTGACTGGGAAAAC Chr7:148127589..148127609 59.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000062031