Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36878
Trapped Gene
1110051M20Rik (ENSMUSG00000040591)
Vector Insertion
Chr 2: 91224017 - 91262022
Public Clones (sanger) W009G12 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000662036 (Chr2:91262023..91262125 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGTACATGGAGGATGCAGTG Chr2:91262088..91262107 60.14 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000662036 (Chr2:91262023..91262125 -)
Downstram Exon
ENSMUSE00000687517 (Chr2:91223886..91224016 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGTACATGGAGGATGCAGTG Chr2:91262088..91262107 60.14 55 GTTCCTTGGCATACGCTGTT Chr2:91223971..91223990 60.14 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000600112 Chr2:91284726..91284837 TGGAAACTACCCGGTCAAAG Chr2:91284773..91284792 59.96 50
upstream ENSMUSE00000662037 Chr2:91284726..91284798 TGGAAACTACCCGGTCAAAG Chr2:91284773..91284792 59.96 50
upstream ENSMUSE00000687518 Chr2:91284726..91284835 TGGAAACTACCCGGTCAAAG Chr2:91284773..91284792 59.96 50
upstream ENSMUSE00000662036 Chr2:91262023..91262125 CGTACATGGAGGATGCAGTG Chr2:91262088..91262107 60.14 55

*** Putative Vector Insertion (Chr 2: 91224017 - 91262022) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000302929 Chr2:91223886..91224016 GTTCCTTGGCATACGCTGTT Chr2:91223971..91223990 60.14 50
downstream ENSMUSE00000687517 Chr2:91223886..91224016 GTTCCTTGGCATACGCTGTT Chr2:91223971..91223990 60.14 50
downstream ENSMUSE00000302919 Chr2:91144906..91144990 GGTACTCCCTCATGGTCAGC Chr2:91144945..91144964 59.53 60
downstream ENSMUSE00000687516 Chr2:91144906..91144990 GGTACTCCCTCATGGTCAGC Chr2:91144945..91144964 59.53 60
downstream ENSMUSE00000450424 Chr2:91124392..91124477 GCATCATCCATGAGCACAAT Chr2:91124435..91124454 59.49 45
downstream ENSMUSE00000302903 Chr2:91122622..91122817 GTTTTCCAGGCGCTGATAGA Chr2:91122623..91122642 60.35 50
downstream ENSMUSE00000302896 Chr2:91121903..91122012 GGTTGATCCCATGATGCTTT Chr2:91121890..91121909 59.76 45
downstream ENSMUSE00000302888 Chr2:91119347..91119410 GTCGTGCATCAGGTCTCCTT Chr2:91119354..91119373 60.27 55
downstream ENSMUSE00000662035 Chr2:91118402..91119114 GCACATGCTCTCAGGAATCA Chr2:91118529..91118548 59.95 50
downstream ENSMUSE00000600111 Chr2:91118401..91119114 GCACATGCTCTCAGGAATCA Chr2:91118529..91118548 59.95 50
downstream ENSMUSE00000687519 Chr2:91117132..91117291 AAAGCTGAGGGCACTGTCTC Chr2:91117153..91117172 59.6 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCTATGTACGGGGTTTCAG Chr2:91228979..91228999 59.45 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCTATGTACGGGGTTTCAG Chr2:91228979..91228999 59.45 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CATCACGAGTCCCACAACCT Chr2:91244113..91244133 60.99 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCTACGTGACTGGGAAAACC Chr2:91229059..91229079 59.45 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040591