Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36882
Trapped Gene
Sbf1 (ENSMUSG00000036529)
Vector Insertion
Chr 15: 89139002 - 89145492
Public Clones W012B02 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000478963 (Chr15:89145493..89145686 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGACTACTTCGTGCTGGTG Chr15:89145515..89145534 61.84 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000478963 (Chr15:89145493..89145686 -)
Downstram Exon
ENSMUSE00000487941 (Chr15:89138916..89139001 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGACTACTTCGTGCTGGTG Chr15:89145515..89145534 61.84 60 AAAGGGTTGTCCTCCCAGTC Chr15:89138913..89138932 60.35 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000478963 Chr15:89145493..89145686 CGGACTACTTCGTGCTGGTG Chr15:89145515..89145534 61.84 60
upstream ENSMUSE00000679916 Chr15:89145493..89145742 CGGACTACTTCGTGCTGGTG Chr15:89145515..89145534 61.84 60

*** Putative Vector Insertion (Chr 15: 89139002 - 89145492) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000487941 Chr15:89138916..89139001 AAAGGGTTGTCCTCCCAGTC Chr15:89138913..89138932 60.35 55
downstream ENSMUSE00000324107 Chr15:89138453..89138590 TTCCTCTCGGGACATAGCTG Chr15:89138528..89138547 60.35 55
downstream ENSMUSE00000324097 Chr15:89138118..89138276 CCAGTCGAGACACCAGAACC Chr15:89138116..89138135 60.71 60
downstream ENSMUSE00000324088 Chr15:89137924..89138034 CAGGTTCCCGATCACATTCT Chr15:89137938..89137957 59.93 50
downstream ENSMUSE00000679915 Chr15:89137603..89137626 CGCTCCTTCCTCAACAGAGT Chr15:89137581..89137600 59.6 55
downstream ENSMUSE00000324083 Chr15:89137261..89137366 GCTACACTACAGCGGCTGAC Chr15:89137259..89137278 58.71 60
downstream ENSMUSE00000324073 Chr15:89137009..89137141 GACGTTGGTAGCTCCTGGAC Chr15:89137039..89137058 59.73 60
downstream ENSMUSE00000324065 Chr15:89136800..89136908 AGGCGTAGGTGTGCTAAGGA Chr15:89136826..89136845 59.9 55
downstream ENSMUSE00000324057 Chr15:89136611..89136724 CACTGTCCCTCCGTCAAGAT Chr15:89136664..89136683 60.11 55
downstream ENSMUSE00000324050 Chr15:89136426..89136503 CTGCATTTTCAGGGAGGAAG Chr15:89136404..89136423 59.81 50
downstream ENSMUSE00000324043 Chr15:89135975..89136088 AAAGAGCCGCAGAAAGACAG Chr15:89136031..89136050 59.76 50
downstream ENSMUSE00000324039 Chr15:89135775..89135903 AATCATCCTCCACCAGTCCA Chr15:89135842..89135861 60.33 50
downstream ENSMUSE00000324034 Chr15:89135594..89135692 CTCTGCCAGTTCCTGGACAT Chr15:89135587..89135606 60.26 55
downstream ENSMUSE00000324026 Chr15:89135312..89135516 CTGGTCCACAATCCACTGAA Chr15:89135369..89135388 59.52 50
downstream ENSMUSE00000324017 Chr15:89135116..89135228 AGCGACGTGCACTGTTGATA Chr15:89135156..89135175 60.48 50
downstream ENSMUSE00000324005 Chr15:89134241..89134390 TGTACGTGCAGGTGAAGCTC Chr15:89134289..89134308 60.06 55
downstream ENSMUSE00000323998 Chr15:89133904..89133972 CAGAAGGCTGTGACCAAAGG Chr15:89133886..89133905 60.82 55
downstream ENSMUSE00000554366 Chr15:89133651..89133809 CCACACTACGTGCTCCTGAA Chr15:89133728..89133747 59.9 55
downstream ENSMUSE00000554365 Chr15:89133308..89133576 AGGGCAGATCGTTCATCATC Chr15:89133511..89133530 60.04 50
downstream ENSMUSE00000554364 Chr15:89133036..89133208 CTGGTGACCCCACTCTCTGT Chr15:89133049..89133068 60.15 60
downstream ENSMUSE00000554363 Chr15:89132883..89132956 TCTTGCTCTCACGGTGTACG Chr15:89132881..89132900 60.05 55
downstream ENSMUSE00000554362 Chr15:89132613..89132808 CATCGAGGACACACTCCTCA Chr15:89132735..89132754 59.82 55
downstream ENSMUSE00000554361 Chr15:89132274..89132401 TCTGCACACTAATGCGCTTC Chr15:89132308..89132327 60.17 50
downstream ENSMUSE00000554360 Chr15:89131204..89131382 ATGTCTGGTGGGTACCGAAG Chr15:89131269..89131288 59.84 55
downstream ENSMUSE00000554359 Chr15:89130959..89131095 CTTCATCAGGTTCCGGGATA Chr15:89131049..89131068 59.89 50
downstream ENSMUSE00000518086 Chr15:89130652..89130859 TAGTCCAAGGCGCTGGTAGT Chr15:89130716..89130735 59.9 55
downstream ENSMUSE00000520048 Chr15:89130136..89130332 CTGGGGAACAATCAGCAATC Chr15:89130283..89130302 60.46 50
downstream ENSMUSE00000516856 Chr15:89129914..89130051 TCAGTGTGTTTCGTCCTGATG Chr15:89129925..89129945 59.74 47.62
downstream ENSMUSE00000518862 Chr15:89125826..89126007 AGACCACTGCTTCGACCACT Chr15:89125943..89125962 59.91 55
downstream ENSMUSE00000516109 Chr15:89125564..89125743 CCTGCCTTGCCTCAAATACT Chr15:89125655..89125674 59.34 50
downstream ENSMUSE00000372062 Chr15:89124834..89124935 AGCAGCTCCACTACCAGCAC Chr15:89124870..89124889 60.62 60
downstream ENSMUSE00000128812 Chr15:89124575..89124760 AGCTGCACCAAGGATACCAC Chr15:89124719..89124738 60.14 55
downstream ENSMUSE00000128814 Chr15:89124376..89124502 TGTGTGGTGGTAACCAAGGA Chr15:89124409..89124428 59.85 50
downstream ENSMUSE00000128808 Chr15:89124170..89124300 TGTAGAACATGGGGGTCCTC Chr15:89124177..89124196 59.78 55
downstream ENSMUSE00000128813 Chr15:89123867..89124097 GAGGACGGCTGTCATAGCAT Chr15:89123880..89123899 60.25 55
downstream ENSMUSE00000128820 Chr15:89120354..89120461 TCAGAAGGCCGACCTAACTC Chr15:89120399..89120418 59.43 55
downstream ENSMUSE00000352674 Chr15:89120036..89120247 AGCTGTCTGGAACTGGCTGT Chr15:89120028..89120047 60.06 55
downstream ENSMUSE00000395770 Chr15:89119453..89119540 AGGCCCCCTTCTTGTATAGG Chr15:89119484..89119503 59.44 55
downstream ENSMUSE00000128819 Chr15:89119243..89119374 TGTCCATTCGGTGGTCATAG Chr15:89119325..89119344 59.37 50
downstream ENSMUSE00000336894 Chr15:89118717..89119156 TAACGACTGGAAGCAGAGCA Chr15:89118994..89119013 59.74 50
downstream ENSMUSE00000679914 Chr15:89118667..89119156 TAACGACTGGAAGCAGAGCA Chr15:89118994..89119013 59.74 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCACACATGTAATCGCCTTG Chr15:89145430..89145450 59.99 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAGCTGTAGGCTCCGTGAC Chr15:89145435..89145455 59.63 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036529