Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36889
Trapped Gene
Pdlim5 (ENSMUSG00000028273)
Vector Insertion
Chr 3: 142054676 - 142058583
Public Clones 5SE305H06 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000586463 (Chr3:142058550..142058582 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000586463 (Chr3:142058550..142058582 -)
Downstram Exon
ENSMUSE00000669150 (Chr3:142054677..142054815 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AGGGTTCAACGTGCAGTTCT Chr3:142054758..142054777 59.77 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000562179 Chr3:142058550..142058599 No primer for this exon
upstream ENSMUSE00000586463 Chr3:142058550..142058582 No primer for this exon
upstream ENSMUSE00000562206 Chr3:142054677..142054814 AAGGTGGCAAGGATTTCAAC Chr3:142054698..142054717 59.03 45
upstream ENSMUSE00000669150 Chr3:142054677..142054815 AAGGTGGCAAGGATTTCAAC Chr3:142054698..142054717 59.03 45

*** Putative Vector Insertion (Chr 3: 142054676 - 142058583) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000332994 Chr3:142015698..142015849 TGAGAACCACGTCCCCTATT Chr3:142015770..142015789 59.4 50
downstream ENSMUSE00000444521 Chr3:141977370..141977412 No primer for this exon
downstream ENSMUSE00000562169 Chr3:141975087..141975178 CTGAGCAGACTCGGAACACA Chr3:141975121..141975140 60.18 55
downstream ENSMUSE00000562201 Chr3:141975087..141975505 TGAGCAGACTCGGAACACAC Chr3:141975122..141975141 60.03 55
downstream ENSMUSE00000669146 Chr3:141972492..141972508 No primer for this exon
downstream ENSMUSE00000669149 Chr3:141969248..141969262 No primer for this exon
downstream ENSMUSE00000669148 Chr3:141967669..141967686 No primer for this exon
downstream ENSMUSE00000414343 Chr3:141967261..141967433 TCCTCAATCAGCCGTTTCTT Chr3:141967322..141967341 59.81 45
downstream ENSMUSE00000413260 Chr3:141966907..141966943 No primer for this exon
downstream ENSMUSE00000669145 Chr3:141966292..141966385 CATGGTGCCAGTCACGTAAT Chr3:141966302..141966321 59.44 50
downstream ENSMUSE00000503680 Chr3:141966185..141966385 CATGGTGCCAGTCACGTAAT Chr3:141966302..141966321 59.44 50
downstream ENSMUSE00000562178 Chr3:141966023..141966385 TGAAGGGGTCAGGTCATTTC Chr3:141966036..141966055 59.9 50
downstream ENSMUSE00000177777 Chr3:141940781..141940965 TAGGTGACTTGACGCTGGTG Chr3:141940783..141940802 59.9 55
downstream ENSMUSE00000177772 Chr3:141922094..141922256 GTTCCGCTCTCTGCACAAGT Chr3:141922127..141922146 60.6 55
downstream ENSMUSE00000177783 Chr3:141912294..141912474 GCCATTGTGTTTTTGCAATG Chr3:141912375..141912394 59.98 40
downstream ENSMUSE00000272616 Chr3:141910259..141910379 AACAGGACACATGCCAGGTC Chr3:141910315..141910334 61 55
downstream ENSMUSE00000177778 Chr3:141907860..141907975 TTGTTCCAAAAAGGGCGTAG Chr3:141907930..141907949 60.1 45
downstream ENSMUSE00000635583 Chr3:141904328..141905733 CGAAACGCCATCATTTCTTT Chr3:141904351..141904370 60.07 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATAATCGCCTTGCAGCACA Chr3:142058514..142058534 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTACGTGACTGGGAAAACC Chr3:142058516..142058536 59.45 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028273