Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI369
Trapped Gene
Zfp42 (ENSMUSG00000051176)
Vector Insertion
Chr 8: 44388334 - 44389829
Public Clones GC1089 (tigem) AE0167 (sanger) AD0198 (sanger) RRM247 (baygenomics) CSG191 (baygenomics)
A063B08 (ggtc) D028A03 (ggtc) P138E05 (ggtc) P027F08 (ggtc) H004C05 (ggtc)
A063A08 (ggtc) P137B08 (ggtc) P098H02 (ggtc) P028B08 (ggtc) P115C02 (ggtc)
M015C04 (ggtc) D028A02 (ggtc) D005C07 (ggtc) PST20759-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000481791 (Chr8:44389830..44389913 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGACACGTGGCAAAAGAAGA Chr8:44389875..44389894 61.22 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000481791 (Chr8:44389830..44389913 -)
Downstram Exon
ENSMUSE00000706533 (Chr8:44388229..44388333 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGACACGTGGCAAAAGAAGA Chr8:44389875..44389894 61.22 50 CCAGCTTGGTCTGCAAAGTT Chr8:44388260..44388279 60.43 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000510068 Chr8:44392195..44392290 CTGGGTACGAGTGGCAGTTT Chr8:44392265..44392284 60.17 55
upstream ENSMUSE00000481791 Chr8:44389830..44389913 GGACACGTGGCAAAAGAAGA Chr8:44389875..44389894 61.22 50

*** Putative Vector Insertion (Chr 8: 44388334 - 44389829) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000706533 Chr8:44388229..44388333 CCAGCTTGGTCTGCAAAGTT Chr8:44388260..44388279 60.43 50
downstream ENSMUSE00000482761 Chr8:44385982..44386059 ATTTGGGGACAACACTTGGA Chr8:44385975..44385994 60.21 45
downstream ENSMUSE00000480945 Chr8:44380422..44381890 CTTTGCGTGGGTTAGGATGT Chr8:44380946..44380965 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGCAGCCAGCAGGTAAGAG Chr8:44389821..44389841 61.14 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGCAGCCAGCAGGTAAGAG Chr8:44389821..44389841 61.14 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GGACACGTGGCAAAAGAAGA Chr8:44389873..44389893 61.22 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGACACGTGGCAAAAGAAGA Chr8:44389873..44389893 61.22 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000051176