Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36904
Trapped Gene
2810485I05Rik (ENSMUSG00000037808)
Vector Insertion
Chr 9: 13634224 - 13635425
Public Clones 3SE286D10 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 20% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000366527 (Chr9:13634169..13634223 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000366527 (Chr9:13634169..13634223 +)
Downstram Exon
ENSMUSE00000311580 (Chr9:13635426..13635581 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon ACAGGTCTGAGGTGCTCCAT Chr9:13635530..13635549 59.71 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000406427 Chr9:13632214..13632505 No primer for this exon
upstream ENSMUSE00000311609 Chr9:13633204..13633268 TCGGATTGCACATCCTATTG Chr9:13633209..13633228 59.5 45
upstream ENSMUSE00000366527 Chr9:13634169..13634223 No primer for this exon

*** Putative Vector Insertion (Chr 9: 13634224 - 13635425) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000311580 Chr9:13635426..13635581 ACAGGTCTGAGGTGCTCCAT Chr9:13635530..13635549 59.71 55
downstream ENSMUSE00000338052 Chr9:13637416..13637615 AGAGCCAGCACAGCAACTTC Chr9:13637446..13637465 60.74 55
downstream ENSMUSE00000335929 Chr9:13640329..13640376 CTGTTTCCACAGTCCCTGCT Chr9:13640377..13640396 60.3 55
downstream ENSMUSE00000311477 Chr9:13640547..13640627 TTCTGAATTGCTGCAGAGGA Chr9:13640576..13640595 59.67 45
downstream ENSMUSE00000311544 Chr9:13641281..13641416 CCCCCACTATCTGCTGACTG Chr9:13641316..13641335 60.67 60
downstream ENSMUSE00000311526 Chr9:13644084..13644185 TGTGCGCTTTTTCCATACTG Chr9:13644165..13644184 59.87 45
downstream ENSMUSE00000340401 Chr9:13648473..13650973 AACAGGCTCATCGGAAAATG Chr9:13650857..13650876 60.07 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAATCGCCTTGCAGCACAT Chr9:13634274..13634294 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000037808