Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36915
Trapped Gene
Dis3 (ENSMUSG00000033166)
Vector Insertion
Chr 14: 99487980 - 99488975
Public Clones 5SE284A06 (ggtc) 3SE284A06 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 73% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000256282 (Chr14:99488837..99488974 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGTCGCTATTGATGGTTGG Chr14:99488861..99488880 59.54 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000256282 (Chr14:99488837..99488974 -)
Downstram Exon
ENSMUSE00000256276 (Chr14:99487981..99488127 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGTCGCTATTGATGGTTGG Chr14:99488861..99488880 59.54 45 AAAAGGGCTGATGAGGAACA Chr14:99488012..99488031 59.67 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000354183 Chr14:99498665..99498959 CACTACCTTCTGCCGGACAC Chr14:99498684..99498703 60.71 60
upstream ENSMUSE00000123364 Chr14:99497902..99498059 CCCCATCTACAAGCGAATCA Chr14:99497960..99497979 60.99 50
upstream ENSMUSE00000123363 Chr14:99496804..99496997 AAGCTGTGCAAGAGGGGATA Chr14:99496817..99496836 59.84 50
upstream ENSMUSE00000123362 Chr14:99495976..99496049 GCCTGACTGCTAACCCTGAA Chr14:99496012..99496031 60.4 55
upstream ENSMUSE00000706432 Chr14:99495976..99496152 ATGTTTCCTCACGCCTCAAT Chr14:99496096..99496115 59.56 45
upstream ENSMUSE00000412638 Chr14:99494392..99494559 TCCCTTAAGCAAGCTCCAAC Chr14:99494499..99494518 59.45 50
upstream ENSMUSE00000256300 Chr14:99490547..99490711 CCGTCTTCCGTGGTTTTAGA Chr14:99490602..99490621 60.1 50
upstream ENSMUSE00000256290 Chr14:99489184..99489297 TACGGCCTACAGGTCGAGTT Chr14:99489250..99489269 59.76 55
upstream ENSMUSE00000256282 Chr14:99488837..99488974 TTGTCGCTATTGATGGTTGG Chr14:99488861..99488880 59.54 45
upstream ENSMUSE00000256276 Chr14:99487981..99488127 GAGCACGATGTTCCTCATCA Chr14:99488042..99488061 59.79 50

*** Putative Vector Insertion (Chr 14: 99487980 - 99488975) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000256269 Chr14:99486953..99487069 TATGTCAGTGCACCCTGGAG Chr14:99486976..99486995 59.7 55
downstream ENSMUSE00000256262 Chr14:99486608..99486709 CTTGATCCAACGCATTTCCT Chr14:99486627..99486646 60.07 45
downstream ENSMUSE00000256253 Chr14:99485266..99485330 GCAACTCTGGAACCATGTCA Chr14:99485284..99485303 59.68 50
downstream ENSMUSE00000440778 Chr14:99485093..99485177 No primer for this exon
downstream ENSMUSE00000553566 Chr14:99483246..99483373 CGCCGAATCAATTCTCATCT Chr14:99483307..99483326 60.18 45
downstream ENSMUSE00000553600 Chr14:99483246..99483373 CGCCGAATCAATTCTCATCT Chr14:99483307..99483326 60.18 45
downstream ENSMUSE00000553561 Chr14:99481869..99481955 CCATGTGGAATCGGATCTCT Chr14:99481893..99481912 59.89 50
downstream ENSMUSE00000553592 Chr14:99481869..99481955 CCATGTGGAATCGGATCTCT Chr14:99481893..99481912 59.89 50
downstream ENSMUSE00000553557 Chr14:99480445..99480601 GTGTTTCCGAAGCAGAGCAT Chr14:99480477..99480496 60.41 50
downstream ENSMUSE00000553589 Chr14:99480445..99480601 GTGTTTCCGAAGCAGAGCAT Chr14:99480477..99480496 60.41 50
downstream ENSMUSE00000553551 Chr14:99478884..99479098 GCGAGTGGCCAGTATCCTTA Chr14:99478966..99478985 60.24 55
downstream ENSMUSE00000553586 Chr14:99478884..99479098 GCGAGTGGCCAGTATCCTTA Chr14:99478966..99478985 60.24 55
downstream ENSMUSE00000553547 Chr14:99478607..99478775 TTTTATGCCGGAAATTGAGG Chr14:99478629..99478648 59.9 40
downstream ENSMUSE00000553584 Chr14:99478607..99478775 TTTTATGCCGGAAATTGAGG Chr14:99478629..99478648 59.9 40
downstream ENSMUSE00000553540 Chr14:99478347..99478505 AAGGCGTGGCTTTGGTTTAT Chr14:99478340..99478359 60.85 45
downstream ENSMUSE00000553583 Chr14:99478347..99478505 AAGGCGTGGCTTTGGTTTAT Chr14:99478340..99478359 60.85 45
downstream ENSMUSE00000553535 Chr14:99477481..99477603 CCATGCGGATTTTCTGATGT Chr14:99477476..99477495 60.86 45
downstream ENSMUSE00000553579 Chr14:99477481..99477603 CCATGCGGATTTTCTGATGT Chr14:99477476..99477495 60.86 45
downstream ENSMUSE00000612595 Chr14:99476489..99476684 ATGCTCTCCATTTTGTTGCTG Chr14:99476528..99476548 60.26 42.86
downstream ENSMUSE00000706431 Chr14:99476489..99476684 ATGCTCTCCATTTTGTTGCTG Chr14:99476528..99476548 60.26 42.86
downstream ENSMUSE00000553530 Chr14:99475853..99476684 CGGAGGACCACGGTAAAGTA Chr14:99476098..99476117 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGGCCCAGGACTGTAATTC Chr14:99488993..99489013 59.93 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGGCCCAGGACTGTAATTC Chr14:99488993..99489013 59.93 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033166