Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36921
Trapped Gene
Tnk2 (ENSMUSG00000022791)
Vector Insertion
Chr 16: 32645195 - 32663824
Public Clones (sanger) 5SD155D11 (ggtc) 3SD076D08 (ggtc) 5SD165F10 (ggtc) 3SD155D11 (ggtc)
5SE128H06 (ggtc) 3SD165F10 (ggtc) (ggtc) 5SD165H09 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000701777 (Chr16:32644729..32645194 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTCTGAGCATCCTCGAAGC Chr16:32645144..32645163 59.71 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000701777 (Chr16:32644729..32645194 +)
Downstram Exon
ENSMUSE00000717799 (Chr16:32663825..32664005 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTCTGAGCATCCTCGAAGC Chr16:32645144..32645163 59.71 55 GCGGGTAATGTTGAGGTCAT Chr16:32663947..32663966 59.82 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000701777 Chr16:32644729..32645194 AGTCTGAGCATCCTCGAAGC Chr16:32645144..32645163 59.71 55
upstream ENSMUSE00000701762 Chr16:32644759..32645194 AGTCTGAGCATCCTCGAAGC Chr16:32645144..32645163 59.71 55
upstream ENSMUSE00000701761 Chr16:32644912..32645194 CATCCTCGAAGCAGTGTCTG Chr16:32645152..32645171 59.57 55
upstream ENSMUSE00000701759 Chr16:32644947..32645194 CATCCTCGAAGCAGTGTCTG Chr16:32645152..32645171 59.57 55

*** Putative Vector Insertion (Chr 16: 32645195 - 32663824) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000619840 Chr16:32663825..32664005 GCGGGTAATGTTGAGGTCAT Chr16:32663947..32663966 59.82 50
downstream ENSMUSE00000717799 Chr16:32663825..32664005 GCGGGTAATGTTGAGGTCAT Chr16:32663947..32663966 59.82 50
downstream ENSMUSE00000619839 Chr16:32665972..32666042 TCATCCATGACTTGCGTTTG Chr16:32666040..32666059 60.67 45
downstream ENSMUSE00000619838 Chr16:32668307..32668528 AACCGCTTTCCACTGAACAC Chr16:32668329..32668348 60.16 50
downstream ENSMUSE00000462682 Chr16:32669473..32669625 CCACACCATACAAGCGAATG Chr16:32669605..32669624 59.99 50
downstream ENSMUSE00000130455 Chr16:32670039..32670316 AGTCCGAAGTCCCCAATCTT Chr16:32670250..32670269 59.94 50
downstream ENSMUSE00000130459 Chr16:32670878..32671004 CATGGGAGAAAGTCCGTGTC Chr16:32670921..32670940 60.51 55
downstream ENSMUSE00000130465 Chr16:32671381..32671527 CAGCACTGGACCATGACATT Chr16:32671472..32671491 59.55 50
downstream ENSMUSE00000130457 Chr16:32671625..32671719 TTCCCTCGATGACAGTGATG Chr16:32671721..32671740 59.63 50
downstream ENSMUSE00000701757 Chr16:32673242..32673366 CGAGTAAAAGCTGGCACCTC Chr16:32673341..32673360 60.01 55
downstream ENSMUSE00000130468 Chr16:32675608..32675802 ATTTCGAGGGAAGGGTCCTA Chr16:32675677..32675696 59.9 50
downstream ENSMUSE00000701756 Chr16:32675608..32675802 ATTTCGAGGGAAGGGTCCTA Chr16:32675677..32675696 59.9 50
downstream ENSMUSE00000130470 Chr16:32677980..32678071 TTCCACACTCAGCAGGTCAG Chr16:32678031..32678050 60.02 55
downstream ENSMUSE00000701755 Chr16:32677980..32678071 TTCCACACTCAGCAGGTCAG Chr16:32678031..32678050 60.02 55
downstream ENSMUSE00000130454 Chr16:32678755..32678799 GAGTGAAGATGGCAGGCTGA Chr16:32678799..32678818 61.52 55
downstream ENSMUSE00000130471 Chr16:32679545..32680893 TAGAGAGCCGATGCGGTAGT Chr16:32680429..32680448 60 55
downstream ENSMUSE00000130473 Chr16:32680986..32681081 CAGCCCTCTGAACACTCCAG Chr16:32681070..32681089 61 60
downstream ENSMUSE00000515017 Chr16:32681238..32681365 CTAGGACCTTGTGGCACTCC Chr16:32681298..32681317 59.72 60
downstream ENSMUSE00000701758 Chr16:32681536..32681539 No primer for this exon
downstream ENSMUSE00000701760 Chr16:32682771..32683578 CACTGCTCTCCAGTCAACCA Chr16:32682800..32682819 60.02 55
downstream ENSMUSE00000701763 Chr16:32682771..32683579 CACTGCTCTCCAGTCAACCA Chr16:32682800..32682819 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTCTGGTGTAATCGCCTTG Chr16:32648237..32648257 60.8 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGCCCTGCATACATAGAG Chr16:32648195..32648215 61.01 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022791