Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36922
Trapped Gene
2210021J22Rik (ENSMUSG00000064284)
Vector Insertion
Chr 15: 85641331 - 85642090
Public Clones 5SD069F06 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000680217 (Chr15:85642069..85642089 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000680217 (Chr15:85642069..85642089 -)
Downstram Exon
ENSMUSE00000680216 (Chr15:85641332..85641478 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CCGTAAATTGCTGGGTCAGT Chr15:85641414..85641433 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000680217 Chr15:85642069..85642089 No primer for this exon
upstream ENSMUSE00000680216 Chr15:85641332..85641478 GACCCAGCAATTTACGGAGA Chr15:85641433..85641452 60.07 50

*** Putative Vector Insertion (Chr 15: 85641331 - 85642090) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000407572 Chr15:85639642..85639754 GCCCCACATAGCTGTAAGGA Chr15:85639648..85639667 60.1 55
downstream ENSMUSE00000390783 Chr15:85638686..85638797 AGAAACCTGGCCTTGTCTGA Chr15:85638716..85638735 59.84 50
downstream ENSMUSE00000647099 Chr15:85637419..85637968 GCTGGATACACCCCTGATGT Chr15:85637650..85637669 59.81 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr15:85642020..85642040 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGGGGAGGTGGTGAGTTT Chr15:85642059..85642079 62.59 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000064284