Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36930
Trapped Gene
Sec61g (ENSMUSG00000078974)
Vector Insertion
Chr 11: 16401653 - 16404842
Public Clones (sanger) 3SD051H02 (ggtc) 5SD051H02 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 96% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000681061 (Chr11:16404739..16404841 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGCTTCTTCGTGAAACTGA Chr11:16404767..16404786 59.57 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000681061 (Chr11:16404739..16404841 -)
Downstram Exon
ENSMUSE00000681055 (Chr11:16401654..16401810 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGCTTCTTCGTGAAACTGA Chr11:16404767..16404786 59.57 45 AGCATTCAGGCAACGCTTTA Chr11:16401708..16401727 60.9 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681064 Chr11:16408107..16408487 AGCTGTAGCGCAGACACTCA Chr11:16408440..16408459 59.95 55
upstream ENSMUSE00000681058 Chr11:16408103..16408169 CTCAATCCGCCATCCAGTAA Chr11:16408103..16408122 60.99 50
upstream ENSMUSE00000681056 Chr11:16407983..16408072 CAGGGGAGGTGAAGAAACTG Chr11:16407986..16408005 59.69 55
upstream ENSMUSE00000681063 Chr11:16406376..16406475 GGACTCAATTCGGCTGGTTA Chr11:16406403..16406422 60.07 50
upstream ENSMUSE00000681061 Chr11:16404739..16404841 TGGCTTCTTCGTGAAACTGA Chr11:16404767..16404786 59.57 45
upstream ENSMUSE00000681055 Chr11:16401654..16401810 TTCTCATCATGGGACGAGTG Chr11:16401777..16401796 59.63 50

*** Putative Vector Insertion (Chr 11: 16401653 - 16404842) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000681057 Chr11:16401390..16401810 TTCATGGCTCTCAGGATGTG Chr11:16401412..16401431 59.79 50
downstream ENSMUSE00000681059 Chr11:16400533..16401810 GGGAAAGACGTTCACTTCCA Chr11:16400980..16400999 60.09 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr11:16401772..16401792 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCTTCTCGTGACTGGGAAA Chr11:16401778..16401798 60.77 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078974