Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36948
Trapped Gene
Hs3st4 (ENSMUSG00000078591)
Vector Insertion
Chr 7: 131127408 - 131540339
Public Clones (sanger) 3SD179H12 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 53% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000669922 (Chr7:131126383..131127407 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTGTCCGTCACCTACCTGT Chr7:131126823..131126842 60.03 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000669922 (Chr7:131126383..131127407 +)
Downstram Exon
ENSMUSE00000669921 (Chr7:131540340..131542503 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTGTCCGTCACCTACCTGT Chr7:131126823..131126842 60.03 60 TGAGTCCGACCTTTGCTCTT Chr7:131540858..131540877 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000669922 Chr7:131126383..131127407 CCTGTCCGTCACCTACCTGT Chr7:131126823..131126842 60.03 60

*** Putative Vector Insertion (Chr 7: 131127408 - 131540339) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000669921 Chr7:131540340..131542503 TGAGTCCGACCTTTGCTCTT Chr7:131540858..131540877 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCACAGGACACCAAATGAGA Chr7:131454432..131454452 59.68 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATTCCGTGACTGGGAAAAC Chr7:131454454..131454474 59.39 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078591