Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3695
Trapped Gene
Chm (ENSMUSG00000025531)
Vector Insertion
Chr X: 110161106 - 110166670
Public Clones AE0688 (sanger) AE0676 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 81% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000295450 (ChrX:110166671..110166769 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000295450 (ChrX:110166671..110166769 -)
Downstram Exon
ENSMUSE00000151438 (ChrX:110160945..110161105 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GGGCCAGAGCACACATAGAC ChrX:110160960..110160979 60.69 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000695401 ChrX:110299050..110299124 TCTCCCTTCGGACTTTGATG ChrX:110299068..110299087 60.19 50
upstream ENSMUSE00000151436 ChrX:110273113..110273179 TCTGCCTGAATCCATCATTG ChrX:110273159..110273178 59.6 45
upstream ENSMUSE00000151428 ChrX:110254323..110254395 GCCAGTTTCAGCTTTTCAGG ChrX:110254351..110254370 59.99 50
upstream ENSMUSE00000295488 ChrX:110252945..110253069 TGAAAATTCAATGTGGCAAGA ChrX:110253029..110253049 59.15 33.33
upstream ENSMUSE00000295483 ChrX:110229625..110230039 TGGTGCACTGCAGAAAAATC ChrX:110229990..110230009 59.85 45
upstream ENSMUSE00000151440 ChrX:110226158..110226274 ACGAGGATTCTTGCATTTCG ChrX:110226177..110226196 60.21 45
upstream ENSMUSE00000295473 ChrX:110225538..110225658 GACCATCCCGATGAGTACAAA ChrX:110225539..110225559 59.81 47.62
upstream ENSMUSE00000295468 ChrX:110223785..110224010 CGGTATGGCAACACTCCATT ChrX:110223833..110223852 60.78 50
upstream ENSMUSE00000151435 ChrX:110193747..110193824 TTCGCCATTCAGTACAGTGC ChrX:110193773..110193792 59.87 50
upstream ENSMUSE00000151434 ChrX:110185526..110185630 No primer for this exon
upstream ENSMUSE00000295458 ChrX:110183188..110183251 TCCAGGGCAGTCCTGATTAC ChrX:110183225..110183244 60.07 55
upstream ENSMUSE00000295453 ChrX:110178456..110178552 CAGTGCCAGCAGAAGAGTCA ChrX:110178520..110178539 60.33 55
upstream ENSMUSE00000295450 ChrX:110166671..110166769 No primer for this exon

*** Putative Vector Insertion (Chr X: 110161106 - 110166670) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000151438 ChrX:110160945..110161105 GGGCCAGAGCACACATAGAC ChrX:110160960..110160979 60.69 60
downstream ENSMUSE00000653896 ChrX:110154201..110157244 TGATTGCACCAAAAGGATGA ChrX:110155034..110155053 60.05 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTAATCGCCTTGCAGCACA ChrX:110166601..110166621 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCGGCAGCTTTAATCGTGAC ChrX:110166613..110166633 61.3 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025531