Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36951
Trapped Gene
Uba1 (ENSMUSG00000001924)
Vector Insertion
Chr X: 20235653 - 20240056
Public Clones 5SP115F05 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000557067 (ChrX:20235452..20235652 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCCTCTATTCAGGCGTCTA ChrX:20235476..20235495 59.29 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000557067 (ChrX:20235452..20235652 +)
Downstram Exon
ENSMUSE00000702619 (ChrX:20240057..20240251 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCCTCTATTCAGGCGTCTA ChrX:20235476..20235495 59.29 55 CTCAAGGAGCCGAAGTCAAG ChrX:20240218..20240237 60.13 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000557067 ChrX:20235452..20235652 CCCCTCTATTCAGGCGTCTA ChrX:20235476..20235495 59.29 55

*** Putative Vector Insertion (Chr X: 20235653 - 20240056) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000702619 ChrX:20240057..20240251 CTCAAGGAGCCGAAGTCAAG ChrX:20240218..20240237 60.13 55
downstream ENSMUSE00000624597 ChrX:20245575..20245691 CACTGAGGACACTTCGGACA ChrX:20245685..20245704 59.86 55
downstream ENSMUSE00000708245 ChrX:20245575..20245691 CACTGAGGACACTTCGGACA ChrX:20245685..20245704 59.86 55
downstream ENSMUSE00000624611 ChrX:20245818..20245876 GTCTGCTTCACTGCCGTTCT ChrX:20245850..20245869 60.6 55
downstream ENSMUSE00000624610 ChrX:20245975..20246143 GAGGAGAGATCAGCCCACTG ChrX:20246142..20246161 59.94 60
downstream ENSMUSE00000624609 ChrX:20246254..20246388 CTCCGCTCGATTTTTACCAA ChrX:20246298..20246317 60.2 45
downstream ENSMUSE00000624608 ChrX:20247330..20247436 No primer for this exon
downstream ENSMUSE00000624607 ChrX:20247670..20247760 CTCCCCATTGGAATCTGTGA ChrX:20247727..20247746 60.86 50
downstream ENSMUSE00000624606 ChrX:20247867..20247999 GGGCTGACATCCATTGAGTT ChrX:20247983..20248002 59.93 50
downstream ENSMUSE00000624605 ChrX:20248482..20248579 TTTGACCTGACTGACGATGC ChrX:20248561..20248580 59.84 50
downstream ENSMUSE00000624604 ChrX:20248816..20248962 GAGCACAGAATTGGTGCAGA ChrX:20248933..20248952 59.99 50
downstream ENSMUSE00000624603 ChrX:20249097..20249273 CACCAGCTCTGTTGCATCTT ChrX:20249120..20249139 59.04 50
downstream ENSMUSE00000624602 ChrX:20249370..20249474 CACTGCATGATGGGCATAAA ChrX:20249407..20249426 60.49 45
downstream ENSMUSE00000624601 ChrX:20249561..20249641 CCCATCGTAACGGTTCTGAC ChrX:20249584..20249603 60.38 55
downstream ENSMUSE00000624600 ChrX:20249942..20250097 CCCAATCATGGCAAAGTTCT ChrX:20249998..20250017 59.93 45
downstream ENSMUSE00000624599 ChrX:20252712..20252877 TAGATGCGCTCAGTGTCAGG ChrX:20252818..20252837 60.16 55
downstream ENSMUSE00000624598 ChrX:20253005..20253201 AGGAAGGGGATTACCACCTG ChrX:20253107..20253126 60.18 55
downstream ENSMUSE00000205823 ChrX:20255325..20255389 TAACATTTTCTGCTGGCTGCT ChrX:20255378..20255398 60.03 42.86
downstream ENSMUSE00000205847 ChrX:20255715..20255910 GGAAAGTTGTGCAGCAGTTG ChrX:20255903..20255922 59.49 50
downstream ENSMUSE00000557030 ChrX:20256517..20256591 TTTGGGTCCAGACCAGAAAG ChrX:20256558..20256577 60.08 50
downstream ENSMUSE00000205845 ChrX:20256719..20256908 ATTGGCACTCTGCAACTCCT ChrX:20256901..20256920 59.87 50
downstream ENSMUSE00000557020 ChrX:20257909..20257997 CAATGTGGCTTTGAGCTCCT ChrX:20257946..20257965 60.4 50
downstream ENSMUSE00000557015 ChrX:20258234..20258326 GGTCTGCAGGGGAAATATCA ChrX:20258321..20258340 59.89 50
downstream ENSMUSE00000557011 ChrX:20258449..20258640 TTGGTGCCCTTGAACTACCT ChrX:20258556..20258575 59.59 50
downstream ENSMUSE00000557005 ChrX:20259029..20259130 CTTCAAAGCGATCCCACAAT ChrX:20259071..20259090 60.07 45
downstream ENSMUSE00000557001 ChrX:20259235..20259335 TTAGCAGCTGGCATGAAGAA ChrX:20259314..20259333 59.71 45
downstream ENSMUSE00000556981 ChrX:20259504..20260305 CTTTGACACTCGGCTCACAA ChrX:20259537..20259556 60.03 50
downstream ENSMUSE00000707343 ChrX:20259504..20259829 CTTTGACACTCGGCTCACAA ChrX:20259537..20259556 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGAGGTAATCGCCTTGCAG ChrX:20235698..20235718 59.48 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTTGGAAGAGGCGTGACTG ChrX:20235692..20235712 60.26 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001924