Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36954
Trapped Gene
4930512M02Rik (ENSMUSG00000062511)
Vector Insertion
Chr 11: 11490054 - 11523928
Public Clones (sanger) 5SH006D08 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000655506 (Chr11:11523908..11523927 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000655506 (Chr11:11523908..11523927 -)
Downstram Exon
ENSMUSE00000330442 (Chr11:11490055..11490122 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TTGGCTGTACCATTGAACCA Chr11:11490046..11490065 59.96 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000494529 Chr11:11527390..11527827 GTGGGACTGCTGGGTTCTAA Chr11:11527395..11527414 60.11 55
upstream ENSMUSE00000711074 Chr11:11527390..11527827 GTGGGACTGCTGGGTTCTAA Chr11:11527395..11527414 60.11 55
upstream ENSMUSE00000330451 Chr11:11524646..11524714 CTGAGAGCCTTTTTGGGAGA Chr11:11524663..11524682 59.54 50
upstream ENSMUSE00000655506 Chr11:11523908..11523927 No primer for this exon
upstream ENSMUSE00000330442 Chr11:11490055..11490122 GGTACAGCCAATCATCCACA Chr11:11490059..11490078 59.37 50

*** Putative Vector Insertion (Chr 11: 11490054 - 11523928) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000404107 Chr11:11489226..11489365 TTTCCAGGGCAAGTTATTGG Chr11:11489228..11489247 59.93 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAACTGAGGCAGCTTTGCAT Chr11:11508876..11508896 60.55 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATAGACGTTGCTTTCCGTGA Chr11:11514872..11514892 58.38 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000062511