Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36960
Trapped Gene
Cacng8 (ENSMUSG00000053395)
Vector Insertion
Chr 7: 3412574 - 3415206
Public Clones 3SD116C11 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 76% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000488528 (Chr7:3412527..3412573 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000488528 (Chr7:3412527..3412573 +)
Downstram Exon
ENSMUSE00000575094 (Chr7:3415207..3415366 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon ACCAGCCGTACGAGTAGTGG Chr7:3415313..3415332 60.19 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000444958 Chr7:3394459..3394846 GTGAAAAGGGCGTTCAGGTA Chr7:3394610..3394629 60.11 50
upstream ENSMUSE00000444940 Chr7:3411539..3411622 AGGACACGGACTACGACCAC Chr7:3411581..3411600 60.03 60
upstream ENSMUSE00000444935 Chr7:3412431..3412522 GGCTTCCAGCATCTTTCCTA Chr7:3412441..3412460 59.41 50
upstream ENSMUSE00000488528 Chr7:3412527..3412573 No primer for this exon

*** Putative Vector Insertion (Chr 7: 3412574 - 3415206) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000575094 Chr7:3415207..3415366 ACCAGCCGTACGAGTAGTGG Chr7:3415313..3415332 60.19 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACATC Chr7:3412624..3412645 63.08 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000053395