Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3697
Trapped Gene
Bmpr2 (ENSMUSG00000067336)
Vector Insertion
Chr 1: 59904017 - 59908021
Public Clones XT0547 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 31% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000545711 (Chr1:59903902..59904016 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGTCTGGCTCATTCTGTGAC Chr1:59903956..59903975 59.42 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000545711 (Chr1:59903902..59904016 +)
Downstram Exon
ENSMUSE00000545708 (Chr1:59908022..59908182 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGTCTGGCTCATTCTGTGAC Chr1:59903956..59903975 59.42 55 GCCGTCATTCTTTACCAGGA Chr1:59908092..59908111 60.07 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000629861 Chr1:59821481..59821572 No primer for this exon
upstream ENSMUSE00000545726 Chr1:59870432..59870602 GGGAGCACGTGTTATGGTCT Chr1:59870542..59870561 60 55
upstream ENSMUSE00000545721 Chr1:59872085..59872255 AATGGAACGTACCGCTTTTG Chr1:59872165..59872184 60 45
upstream ENSMUSE00000545719 Chr1:59898275..59898385 TGCTTTGGCATCAGTTTCTG Chr1:59898315..59898334 59.99 45
upstream ENSMUSE00000545716 Chr1:59899587..59899678 AGACCGGAAACAGGGTCTTC Chr1:59899588..59899607 60.49 55
upstream ENSMUSE00000545712 Chr1:59902322..59902552 TTGCTCGCTTCATAGTTGGA Chr1:59902470..59902489 59.57 45
upstream ENSMUSE00000545711 Chr1:59903902..59904016 CGTCTGGCTCATTCTGTGAC Chr1:59903956..59903975 59.42 55

*** Putative Vector Insertion (Chr 1: 59904017 - 59908021) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000545708 Chr1:59908022..59908182 GCCGTCATTCTTTACCAGGA Chr1:59908092..59908111 60.07 50
downstream ENSMUSE00000545704 Chr1:59909138..59909285 GATGAGTCCAAGCGCATACA Chr1:59909248..59909267 59.83 50
downstream ENSMUSE00000601640 Chr1:59916017..59916153 AAATGTGGGATGGTTTCCAA Chr1:59916081..59916100 60.03 40
downstream ENSMUSE00000545695 Chr1:59920625..59920797 TGAGTTCAGCCATCCTCTCC Chr1:59920727..59920746 60.35 55
downstream ENSMUSE00000545693 Chr1:59924180..59925459 GCTAGGGATTCGAGCTTGTG Chr1:59924396..59924415 59.98 55
downstream ENSMUSE00000629860 Chr1:59927079..59927703 TCCTGATTTGCCATCTTGTG Chr1:59927113..59927132 59.65 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr1:59904067..59904087 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCACACAGAATTACCACGAGGA Chr1:59906995..59907017 60.55 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000067336