Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36989
Trapped Gene
Mrpl2 (ENSMUSG00000002767)
Vector Insertion
Chr 17: 46786058 - 46786832
Public Clones CMHD-GT_543F4-5S (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 77% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000136807 (Chr17:46785984..46786057 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000136807 (Chr17:46785984..46786057 +)
Downstram Exon
ENSMUSE00000695537 (Chr17:46786833..46787080 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000350685 Chr17:46783197..46783347 No primer for this exon
upstream ENSMUSE00000695541 Chr17:46783199..46783347 No primer for this exon
upstream ENSMUSE00000695544 Chr17:46783219..46783347 No primer for this exon
upstream ENSMUSE00000136809 Chr17:46784339..46784507 No primer for this exon
upstream ENSMUSE00000695543 Chr17:46784345..46784507 No primer for this exon
upstream ENSMUSE00000542551 Chr17:46785186..46785327 No primer for this exon
upstream ENSMUSE00000542549 Chr17:46785421..46785536 No primer for this exon
upstream ENSMUSE00000136810 Chr17:46785608..46785718 No primer for this exon
upstream ENSMUSE00000695540 Chr17:46785619..46785718 No primer for this exon
upstream ENSMUSE00000136807 Chr17:46785984..46786057 No primer for this exon
upstream ENSMUSE00000695538 Chr17:46785984..46786057 No primer for this exon

*** Putative Vector Insertion (Chr 17: 46786058 - 46786832) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000412005 Chr17:46786833..46787081 No primer for this exon
downstream ENSMUSE00000695537 Chr17:46786833..46787080 No primer for this exon
downstream ENSMUSE00000695542 Chr17:46786833..46787088 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGAACGGGACAGCCATTAT Chr17:46786011..46786031 59.82 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGAACGGGACAGCCATTAT Chr17:46786011..46786031 59.82 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000002767