Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36993
Trapped Gene
4931414P19Rik (ENSMUSG00000022179)
Vector Insertion
Chr 14: 55209958 - 55214789
Public Clones CMHD-GT_537E1-5S (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 37% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000376152 (Chr14:55213951..55214788 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCACCGCTGATGAAGATAG Chr14:55214219..55214238 59.97 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000376152 (Chr14:55213951..55214788 -)
Downstram Exon
ENSMUSE00000322907 (Chr14:55209959..55210276 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCACCGCTGATGAAGATAG Chr14:55214219..55214238 59.97 50 GGGACCAGCACTCGTTGTAT Chr14:55210202..55210221 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000648788 Chr14:55224640..55224745 TCATCTTGTGTGCGTTTTCC Chr14:55224676..55224695 59.7 45
upstream ENSMUSE00000376152 Chr14:55213951..55214788 TGCACCGCTGATGAAGATAG Chr14:55214219..55214238 59.97 50
upstream ENSMUSE00000322907 Chr14:55209959..55210276 CAGAGGGCATCCTCAGAGAC Chr14:55210161..55210180 59.94 60

*** Putative Vector Insertion (Chr 14: 55209958 - 55214789) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000322893 Chr14:55204773..55204834 TGCACATTGTGGACCAGTTT Chr14:55204793..55204812 60.01 45
downstream ENSMUSE00000124178 Chr14:55204489..55204592 CTCCTGCTTGAGCTTTTCCA Chr14:55204510..55204529 60.65 50
downstream ENSMUSE00000124176 Chr14:55203816..55203928 TCTCGCCTCTTGGTAAGGAA Chr14:55203870..55203889 59.95 50
downstream ENSMUSE00000322863 Chr14:55202500..55203543 ACCCTGGACTGCTCTCTTCA Chr14:55202681..55202700 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGACCTATCCCCTCCATGCT Chr14:55214769..55214789 59.92 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGACCTATCCCCTCCATGCT Chr14:55214769..55214789 59.92 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022179