Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36994
Trapped Gene
Vat1 (ENSMUSG00000034993)
Vector Insertion
Chr 11: 101321690 - 101323602
Public Clones CMHD-GT_537C7-5S (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 74% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000332719 (Chr11:101323512..101323601 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACATCGTCATGGACCCTCT Chr11:101323577..101323596 59.93 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000332719 (Chr11:101323512..101323601 -)
Downstram Exon
ENSMUSE00000404526 (Chr11:101321691..101321932 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACATCGTCATGGACCCTCT Chr11:101323577..101323596 59.93 55 CACGCTATTGACGAGTTCCA Chr11:101321744..101321763 59.86 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000375873 Chr11:101327022..101327455 GCTTCGGTGGCTACGATAAG Chr11:101327226..101327245 59.87 55
upstream ENSMUSE00000240558 Chr11:101324223..101324430 CACCGCCTACATGGTTCTCT Chr11:101324277..101324296 60.13 55
upstream ENSMUSE00000378248 Chr11:101323704..101323874 ACGTGACAGTGTTTGGAACG Chr11:101323810..101323829 59.64 50
upstream ENSMUSE00000332719 Chr11:101323512..101323601 GACATCGTCATGGACCCTCT Chr11:101323577..101323596 59.93 55
upstream ENSMUSE00000404526 Chr11:101321691..101321932 TCTGTACAATCAGGGCCACA Chr11:101321729..101321748 60.11 50

*** Putative Vector Insertion (Chr 11: 101321690 - 101323602) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000355051 Chr11:101320053..101321590 CAAACTCAAGCCGGAAGAAG Chr11:101320881..101320900 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGTTGTCCCTCTTTGACAG Chr11:101323600..101323620 59.55 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGTTGTCCCTCTTTGACAG Chr11:101323600..101323620 59.55 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034993