Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI370
Trapped Gene
Urm1 (ENSMUSG00000069020)
Vector Insertion
Chr 2: 29682956 - 29688211
Public Clones GC1099 (tigem) (sanger) (ggtc) (ggtc) IST10015C4 (tigm) IST14272B1 (tigm)
IST14580G5 (tigm) IST10015C4 (tigm) IST14550E8 (tigm)
Private Clones OST464205 (lexicon) OST429752 (lexicon) OST392821 (lexicon) OST322637 (lexicon)
OST302924 (lexicon) OST298472 (lexicon) OST298214 (lexicon) OST284525 (lexicon)
OST284495 (lexicon) OST270734 (lexicon) OST266734 (lexicon) OST266324 (lexicon)
OST261586 (lexicon) OST260911 (lexicon) OST260483 (lexicon) OST252481 (lexicon)
OST251767 (lexicon) OST240804 (lexicon) OST227236 (lexicon) OST222632 (lexicon)
OST220294 (lexicon) OST215354 (lexicon) OST170104 (lexicon) OST134715 (lexicon)
OST133881 (lexicon) OST133133 (lexicon) OST33421 (lexicon)
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000568263 (Chr2:29682904..29682955 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGCCCTTATGTGTGAAGGTG Chr2:29682928..29682947 61.48 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000568263 (Chr2:29682904..29682955 +)
Downstram Exon
ENSMUSE00000568262 (Chr2:29688212..29688282 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGCCCTTATGTGTGAAGGTG Chr2:29682928..29682947 61.48 55 CAAGGCGACTTGATGCTTTT Chr2:29688266..29688285 60.39 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000568263 Chr2:29682904..29682955 CGCCCTTATGTGTGAAGGTG Chr2:29682928..29682947 61.48 55

*** Putative Vector Insertion (Chr 2: 29682956 - 29688211) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000568262 Chr2:29688212..29688282 CAAGGCGACTTGATGCTTTT Chr2:29688266..29688285 60.39 45
downstream ENSMUSE00000568261 Chr2:29696922..29697003 GAACAGCTCTGGTCGCTCTT Chr2:29696989..29697008 59.75 55
downstream ENSMUSE00000568260 Chr2:29698241..29698289 GTTCCCAGTCGGCATCATTA Chr2:29698287..29698306 60.86 50
downstream ENSMUSE00000568259 Chr2:29698623..29699582 GAGTTGTAGGCAGCCTGGAG Chr2:29699372..29699391 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTGTATGGCAGGCCTTATT Chr2:29682979..29682999 59.21 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTGTATGGCAGGCCTTATT Chr2:29682979..29682999 59.21 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000069020