Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37005
Trapped Gene
OTTMUSG00000010069 (ENSMUSG00000078518)
Vector Insertion
Chr 4: 138426906 - 138429503
Public Clones CMHD-GT_513D7-3 (cmhd) CMHD-GT_532G5-5S (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 51% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000667615 (Chr4:138429289..138429502 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCTGCCCTTGGTTCCATAA Chr4:138429425..138429444 60.07 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000667615 (Chr4:138429289..138429502 -)
Downstram Exon
ENSMUSE00000667614 (Chr4:138426907..138427307 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCTGCCCTTGGTTCCATAA Chr4:138429425..138429444 60.07 50 CTGCTCTGGACCCAAGACTC Chr4:138427186..138427205 59.99 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000667616 Chr4:138429840..138429879 No primer for this exon
upstream ENSMUSE00000667615 Chr4:138429289..138429502 CTCTGCCCTTGGTTCCATAA Chr4:138429425..138429444 60.07 50
upstream ENSMUSE00000667614 Chr4:138426907..138427307 GAGTCTTGGGTCCAGAGCAG Chr4:138427208..138427227 59.99 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGATGGATAATCGCCTTG Chr4:138429441..138429461 60.57 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGGACGTGACTGGGAAAAC Chr4:138429437..138429457 59.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078518