Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37028
Trapped Gene
Gm757 (ENSMUSG00000075482)
Vector Insertion
Chr 2: 25091861 - 25092151
Public Clones CMHD-GT_193B4-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000646992 (Chr2:25092152..25092307 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTAATGCGAACCCAAGGAG Chr2:25092235..25092254 59.19 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000646992 (Chr2:25092152..25092307 -)
Downstram Exon
ENSMUSE00000569378 (Chr2:25089996..25091860 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTAATGCGAACCCAAGGAG Chr2:25092235..25092254 59.19 50 CTGGCTGCTGAGTGATGGTA Chr2:25091477..25091496 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000646992 Chr2:25092152..25092307 AGTAATGCGAACCCAAGGAG Chr2:25092235..25092254 59.19 50

*** Putative Vector Insertion (Chr 2: 25091861 - 25092151) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000569378 Chr2:25089996..25091860 CTGGCTGCTGAGTGATGGTA Chr2:25091477..25091496 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAGCGGATGCAGGTAAGAG Chr2:25092143..25092163 59.98 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGCGGATGCAGGTAAGAG Chr2:25092143..25092163 59.98 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000075482