Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37043
Trapped Gene
Entpd3 (ENSMUSG00000041608)
Vector Insertion
Chr 9: 120471154 - 120475422
Public Clones CMHD-GT_242E1-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 85% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000260888 (Chr9:120471016..120471153 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCCTCAGATACGCTTTGAA Chr9:120471128..120471147 60.35 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000260888 (Chr9:120471016..120471153 +)
Downstram Exon
ENSMUSE00000405421 (Chr9:120475423..120476934 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCCTCAGATACGCTTTGAA Chr9:120471128..120471147 60.35 50 CATTTAAGCACGGGACAGGT Chr9:120475768..120475787 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000446532 Chr9:120448963..120449001 No primer for this exon
upstream ENSMUSE00000261025 Chr9:120449770..120449821 No primer for this exon
upstream ENSMUSE00000261004 Chr9:120453077..120453204 CTGCTTGTGAGCATTGTGGT Chr9:120453124..120453143 59.9 50
upstream ENSMUSE00000355416 Chr9:120463187..120463304 ACAGGAGTGGTCAGCCAAAC Chr9:120463265..120463284 60.16 55
upstream ENSMUSE00000446502 Chr9:120464763..120464913 TCAAGGAACAGGTCCCAGAG Chr9:120464835..120464854 60.23 55
upstream ENSMUSE00000411151 Chr9:120466509..120466668 ACAGCAGCTCGTGAAGTCCT Chr9:120466522..120466541 60.21 55
upstream ENSMUSE00000260949 Chr9:120467453..120467686 CAGTGCTATGGCCAGAATGA Chr9:120467633..120467652 59.82 50
upstream ENSMUSE00000260927 Chr9:120469598..120469870 TTACCAGCCCAAGGTTCAAG Chr9:120469840..120469859 60.1 50
upstream ENSMUSE00000260909 Chr9:120470038..120470148 CTACACAGCCAGTGCGCTAA Chr9:120470055..120470074 60.22 55
upstream ENSMUSE00000260888 Chr9:120471016..120471153 GGCCTCAGATACGCTTTGAA Chr9:120471128..120471147 60.35 50

*** Putative Vector Insertion (Chr 9: 120471154 - 120475422) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000405421 Chr9:120475423..120476934 CATTTAAGCACGGGACAGGT Chr9:120475768..120475787 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTGGCCTCAGATACGCTTT Chr9:120474126..120474146 59.48 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAAGGTTTGTGGCGTGACT Chr9:120471192..120471212 60.16 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041608