Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37049
Trapped Gene
Cadm1 (ENSMUSG00000032076)
Vector Insertion
Chr 9: 47618227 - 47621855
Public Clones CMHD-GT_528D4-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 56% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000473772 (Chr9:47618127..47618226 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTAACGTGTGAAGCCATCG Chr9:47618197..47618216 59.2 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000473772 (Chr9:47618127..47618226 +)
Downstram Exon
ENSMUSE00000461284 (Chr9:47621856..47622028 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTAACGTGTGAAGCCATCG Chr9:47618197..47618216 59.2 50 TAGTCCGAATGAGCCTTTCC Chr9:47622014..47622033 59.27 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000699728 Chr9:47338256..47338588 CAGCGCATCTCATTAGCATC Chr9:47338372..47338391 59.55 50
upstream ENSMUSE00000699721 Chr9:47338340..47338588 CAGCGCATCTCATTAGCATC Chr9:47338372..47338391 59.55 50
upstream ENSMUSE00000699740 Chr9:47338340..47338588 CAGCGCATCTCATTAGCATC Chr9:47338372..47338391 59.55 50
upstream ENSMUSE00000468394 Chr9:47338456..47338588 CTCCTGCTGTTGCTCCTTTC Chr9:47338546..47338565 60.13 55
upstream ENSMUSE00000699702 Chr9:47596050..47596200 GGAGAAGTGGCAACCATCAG Chr9:47596098..47596117 60.66 55
upstream ENSMUSE00000362801 Chr9:47596054..47596200 GGAGAAGTGGCAACCATCAG Chr9:47596098..47596117 60.66 55
upstream ENSMUSE00000535523 Chr9:47597780..47597932 CAATCTCGGATGAAGGGAGA Chr9:47597852..47597871 60.15 50
upstream ENSMUSE00000535518 Chr9:47605490..47605627 CAGAAAGACACGGCAGTTGA Chr9:47605519..47605538 60.03 50
upstream ENSMUSE00000467679 Chr9:47607455..47607613 CCAGTCAGCTGATGCTGAAG Chr9:47607497..47607516 59.73 55
upstream ENSMUSE00000473772 Chr9:47618127..47618226 GTTAACGTGTGAAGCCATCG Chr9:47618197..47618216 59.2 50

*** Putative Vector Insertion (Chr 9: 47618227 - 47621855) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000461284 Chr9:47621856..47622028 TAGTCCGAATGAGCCTTTCC Chr9:47622014..47622033 59.27 50
downstream ENSMUSE00000216272 Chr9:47626817..47626900 TGGGAGGAGGGATAGTTGTG Chr9:47626846..47626865 59.92 55
downstream ENSMUSE00000216271 Chr9:47637460..47637492 CGTGAACTGCTGGTTCTGTC Chr9:47637495..47637514 59.47 55
downstream ENSMUSE00000216275 Chr9:47656250..47656381 AAATAGCGGCCCAGAATGAT Chr9:47656370..47656389 60.79 45
downstream ENSMUSE00000488995 Chr9:47658355..47658473 ATAGCTGTGTCTGCGTCTGC Chr9:47658418..47658437 59.22 55
downstream ENSMUSE00000699718 Chr9:47658355..47659112 AGAAACTGGCAACAGGGAGA Chr9:47658977..47658996 59.84 50
downstream ENSMUSE00000699720 Chr9:47658355..47661463 AAACCCTTTCAACGACATGC Chr9:47660719..47660738 59.98 45
downstream ENSMUSE00000699727 Chr9:47658355..47661468 AAACCCTTTCAACGACATGC Chr9:47660719..47660738 59.98 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGAGGGTCGTGAGCAGTAA Chr9:47618252..47618272 59.03 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGAGGGTCGTGAGCAGTAA Chr9:47618252..47618272 59.03 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032076