Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37078
Trapped Gene
4833424O15Rik (ENSMUSG00000033342)
Vector Insertion
Chr 3: 117374953 - 117389533
Public Clones CMHD-GT_244A9-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 97% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000670034 (Chr3:117374818..117374952 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCAATGACCAACATTCCTC Chr3:117374895..117374914 60.33 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000670034 (Chr3:117374818..117374952 +)
Downstram Exon
ENSMUSE00000351390 (Chr3:117389534..117392424 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCAATGACCAACATTCCTC Chr3:117374895..117374914 60.33 50 AGGACCAGTAGCCTTGAGCA Chr3:117391587..117391606 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000412323 Chr3:117278379..117278850 GTGAACGTGCAGGGATTCTT Chr3:117278725..117278744 60.12 50
upstream ENSMUSE00000322463 Chr3:117323887..117324019 TGTTTTGCCTGCAATTAGCC Chr3:117323909..117323928 61.13 45
upstream ENSMUSE00000322458 Chr3:117328573..117328823 CTACGCTGCCACGTATCTGA Chr3:117328802..117328821 60.03 55
upstream ENSMUSE00000322453 Chr3:117365371..117365547 CCAAAGGAACCAGACTTGCT Chr3:117365396..117365415 59.33 50
upstream ENSMUSE00000322446 Chr3:117374818..117374937 GCCAATGACCAACATTCCTC Chr3:117374895..117374914 60.33 50
upstream ENSMUSE00000670034 Chr3:117374818..117374952 GCCAATGACCAACATTCCTC Chr3:117374895..117374914 60.33 50

*** Putative Vector Insertion (Chr 3: 117374953 - 117389533) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000351390 Chr3:117389534..117392424 AGGACCAGTAGCCTTGAGCA Chr3:117391587..117391606 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TACAGTGGCTCTGGCTCTTG Chr3:117380958..117380978 59.19 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TACAGTGGCTCTGGCTCTTG Chr3:117380958..117380978 59.19 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033342