Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37087
Trapped Gene
Susd4 (ENSMUSG00000038576)
Vector Insertion
Chr 1: 184763407 - 184784087
Public Clones CMHD-GT_507G2-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 24% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000398223 (Chr1:184763194..184763406 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GATGACCTCAACGTGTGTGC Chr1:184763199..184763218 60.17 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000398223 (Chr1:184763194..184763406 +)
Downstram Exon
ENSMUSE00000303917 (Chr1:184784088..184784261 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GATGACCTCAACGTGTGTGC Chr1:184763199..184763218 60.17 55 AGGTCAGGGTAGCGGATCTT Chr1:184784202..184784221 60.1 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000534327 Chr1:184695037..184695319 CAGAGACTCTTGGCCGTGAT Chr1:184695250..184695269 60.41 55
upstream ENSMUSE00000398223 Chr1:184763194..184763406 GATGACCTCAACGTGTGTGC Chr1:184763199..184763218 60.17 55

*** Putative Vector Insertion (Chr 1: 184763407 - 184784087) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000303917 Chr1:184784088..184784261 AGGTCAGGGTAGCGGATCTT Chr1:184784202..184784221 60.1 55
downstream ENSMUSE00000303905 Chr1:184788553..184788741 AGCGATAGGCGATCACAGTT Chr1:184788648..184788667 59.87 50
downstream ENSMUSE00000686231 Chr1:184817465..184817662 GAGGCTGTAGCCAGGATCAC Chr1:184817589..184817608 59.83 60
downstream ENSMUSE00000303893 Chr1:184817471..184817662 CTCCATACTGGCAGGTGATGT Chr1:184817625..184817645 60.01 52.38
downstream ENSMUSE00000303883 Chr1:184818899..184819043 ATCTTCCACGTGGTCAGGAG Chr1:184818950..184818969 60.11 55
downstream ENSMUSE00000303873 Chr1:184822014..184822396 CACTCGAGCTACCGTTCACA Chr1:184822120..184822139 60.05 55
downstream ENSMUSE00000534325 Chr1:184825330..184825785 ACCAGGCTATGGGTCCTCTT Chr1:184825367..184825386 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCACCCACAGACACCTGTTA Chr1:184775440..184775460 59.44 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGTCCCAAGTGACAAACCT Chr1:184775372..184775392 61.18 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038576