Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37106
Trapped Gene
Clns1a (ENSMUSG00000025439)
Vector Insertion
Chr 7: 104861245 - 104862416
Public Clones CMHD-GT_534F11-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 67% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000150857 (Chr7:104861137..104861244 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAGACCCTGAGGATGAAGA Chr7:104861181..104861200 60.19 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000150857 (Chr7:104861137..104861244 +)
Downstram Exon
ENSMUSE00000150856 (Chr7:104862417..104862590 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAGACCCTGAGGATGAAGA Chr7:104861181..104861200 60.19 55 AATCTCTCCAACGTGGCTTG Chr7:104862510..104862529 60.26 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000364679 Chr7:104845212..104845379 GGCAATGAGCTTCCTCAAAA Chr7:104845251..104845270 60.33 45
upstream ENSMUSE00000150854 Chr7:104854099..104854235 CCAAACGCTTACCCTCAAGA Chr7:104854181..104854200 60.24 50
upstream ENSMUSE00000150852 Chr7:104860210..104860308 AATTTCGATTTGTGCCCAGT Chr7:104860276..104860295 59.43 40
upstream ENSMUSE00000150857 Chr7:104861137..104861244 CCAGACCCTGAGGATGAAGA Chr7:104861181..104861200 60.19 55

*** Putative Vector Insertion (Chr 7: 104861245 - 104862416) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000150856 Chr7:104862417..104862590 AATCTCTCCAACGTGGCTTG Chr7:104862510..104862529 60.26 50
downstream ENSMUSE00000150848 Chr7:104864961..104865049 GTTGGTGTGGTTTCCACCTC Chr7:104864991..104865010 60.26 55
downstream ENSMUSE00000387819 Chr7:104866729..104867318 TATTGCGAGATGTGGCTGAG Chr7:104867197..104867216 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTTAATCGCCTTGCAGCAC Chr7:104861293..104861313 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCGGACGACTATGATGGAGA Chr7:104861203..104861223 59.19 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025439