Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3714
Trapped Gene
1810032O08Rik (ENSMUSG00000020812)
Vector Insertion
Chr 11: 116535690 - 116536821
Public Clones XT0178 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000669677 (Chr11:116535614..116535689 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000669677 (Chr11:116535614..116535689 +)
Downstram Exon
ENSMUSE00000669676 (Chr11:116536822..116537110 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000669674 Chr11:116532983..116533070 No primer for this exon
upstream ENSMUSE00000712316 Chr11:116532995..116533070 No primer for this exon
upstream ENSMUSE00000714124 Chr11:116532995..116533070 No primer for this exon
upstream ENSMUSE00000645978 Chr11:116533478..116533669 No primer for this exon
upstream ENSMUSE00000717803 Chr11:116533478..116533669 No primer for this exon
upstream ENSMUSE00000109477 Chr11:116533978..116534052 No primer for this exon
upstream ENSMUSE00000386181 Chr11:116535252..116535385 No primer for this exon
upstream ENSMUSE00000669672 Chr11:116535614..116537112 No primer for this exon
upstream ENSMUSE00000669677 Chr11:116535614..116535689 No primer for this exon

*** Putative Vector Insertion (Chr 11: 116535690 - 116536821) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000669676 Chr11:116536822..116537110 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTCGGGATGCCTCTATCTG Chr11:116535671..116535691 59.79 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTCGGGATGCCTCTATCTG Chr11:116535671..116535691 59.79 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020812