Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37140
Trapped Gene
Abca7 (ENSMUSG00000035722)
Vector Insertion
Chr 10: 79477933 - 79478050
Public Clones CMHD-GT_112H6-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 98% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000312886 (Chr10:79477692..79477932 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000312886 (Chr10:79477692..79477932 +)
Downstram Exon
ENSMUSE00000365113 (Chr10:79478051..79478313 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCCTCTTCCCCTTGGTCTTT Chr10:79478091..79478110 60.04 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000381185 Chr10:79460360..79460425 ACCTATCGACGGAGACAACC Chr10:79460405..79460424 59.02 55
upstream ENSMUSE00000313229 Chr10:79460514..79460607 ATCCTAGTGGCTGTCCGTCA Chr10:79460559..79460578 60.68 55
upstream ENSMUSE00000313224 Chr10:79460759..79460900 AGCCTGGGGTCCTGAGTAAC Chr10:79460867..79460886 60.51 60
upstream ENSMUSE00000313216 Chr10:79460989..79461101 No primer for this exon
upstream ENSMUSE00000313204 Chr10:79461196..79461269 ACGACCACAGGAGAGTGACC Chr10:79461197..79461216 60.16 60
upstream ENSMUSE00000313199 Chr10:79461502..79461582 GGGTCAAGCCCAGGATTCTA Chr10:79461522..79461541 61.35 55
upstream ENSMUSE00000313189 Chr10:79462126..79462336 ATTGGTACGAAGCCAACCAG Chr10:79462262..79462281 59.99 50
upstream ENSMUSE00000313184 Chr10:79462426..79462565 ACTGGATGACCACCCTGTGT Chr10:79462454..79462473 60.29 55
upstream ENSMUSE00000313176 Chr10:79463457..79463573 GTGAACCAGACCTTCGAGGA Chr10:79463457..79463476 60.24 55
upstream ENSMUSE00000313168 Chr10:79463668..79463835 TGGCTGGAATCCTAGGACAA Chr10:79463807..79463826 60.59 50
upstream ENSMUSE00000313160 Chr10:79464235..79464464 GACCCATCCGAACTGTCATC Chr10:79464361..79464380 60.33 55
upstream ENSMUSE00000313152 Chr10:79464780..79464956 GTCCGTCAGCAGATCCTTTC Chr10:79464794..79464813 59.81 55
upstream ENSMUSE00000313145 Chr10:79465252..79465474 TGCGTTGCTGGTATTAGTGC Chr10:79465450..79465469 59.9 50
upstream ENSMUSE00000313139 Chr10:79465576..79465797 CGCCTATTTTGCGCTCTATC Chr10:79465716..79465735 59.97 50
upstream ENSMUSE00000313131 Chr10:79465877..79466078 GAAAGCCTGGCGCTACTAGA Chr10:79465913..79465932 59.75 55
upstream ENSMUSE00000313126 Chr10:79466542..79466652 GCCAGTATGGAATCCCTGAA Chr10:79466542..79466561 59.89 50
upstream ENSMUSE00000313120 Chr10:79467126..79467297 AAACATTTTCGTGGCTGTCC Chr10:79467185..79467204 59.98 45
upstream ENSMUSE00000313113 Chr10:79467464..79467595 GGCCATGATGTACAAACCAAC Chr10:79467516..79467536 60.11 47.62
upstream ENSMUSE00000313105 Chr10:79467699..79467838 GGAACGTCTGATACGGGATG Chr10:79467774..79467793 60.34 55
upstream ENSMUSE00000574927 Chr10:79468388..79468525 GTGTGGTCATCATGGACGAG Chr10:79468439..79468458 59.96 55
upstream ENSMUSE00000313086 Chr10:79468733..79468920 GCTGCGGTTACTACCTGACC Chr10:79468859..79468878 59.76 60
upstream ENSMUSE00000313077 Chr10:79468997..79469054 CCAGACGGGAAAAGAAGTCA Chr10:79469013..79469032 60.22 50
upstream ENSMUSE00000313071 Chr10:79469178..79469455 CACACGAGGAACCTCAGACA Chr10:79469188..79469207 59.86 55
upstream ENSMUSE00000313065 Chr10:79469631..79469667 TTCCTAAAGGTGGTGGAGGA Chr10:79469634..79469653 59.52 50
upstream ENSMUSE00000313057 Chr10:79469881..79469973 CCAGAGGCATCAGTTCTGGA Chr10:79469940..79469959 61.36 55
upstream ENSMUSE00000313046 Chr10:79470069..79470196 CTCCACAAGCGTTTTCTGCT Chr10:79470143..79470162 60.57 50
upstream ENSMUSE00000313034 Chr10:79470399..79470523 CCCTCAGGTCTCGTTCTTCA Chr10:79470503..79470522 60.38 55
upstream ENSMUSE00000313026 Chr10:79470608..79470706 No primer for this exon
upstream ENSMUSE00000313018 Chr10:79470890..79471177 GGCCGAAATGTGTCTGACTT Chr10:79471122..79471141 60.12 50
upstream ENSMUSE00000313009 Chr10:79471284..79471316 AAGTGGGTGGATGAGGTCAG Chr10:79471297..79471316 59.96 55
upstream ENSMUSE00000313000 Chr10:79471408..79471585 ATGCGCTAGACCGTATCCTG Chr10:79471515..79471534 60.26 55
upstream ENSMUSE00000312992 Chr10:79471673..79471842 ACATGCCCTCCTACCATCTG Chr10:79471741..79471760 59.95 55
upstream ENSMUSE00000574926 Chr10:79472603..79472780 TTTGTCCCAGCCAGCTTTAC Chr10:79472658..79472677 60.25 50
upstream ENSMUSE00000312973 Chr10:79472896..79473011 GCCTTTCAGCAGAGAGCCTA Chr10:79472941..79472960 59.86 55
upstream ENSMUSE00000312965 Chr10:79473781..79473925 CACCTGCATCAACCTCTTCA Chr10:79473853..79473872 59.83 50
upstream ENSMUSE00000312957 Chr10:79474020..79474143 AGGGCTCATTGACATGGTTC Chr10:79474088..79474107 59.93 50
upstream ENSMUSE00000312947 Chr10:79474458..79474587 AGGGACCTCTGTTCCTCCTC Chr10:79474527..79474546 59.66 60
upstream ENSMUSE00000312937 Chr10:79474660..79474780 AGGGGGATGTGCTAGTCCTC Chr10:79474746..79474765 60.48 60
upstream ENSMUSE00000312929 Chr10:79474869..79474931 TTTACCGTGGGCAGAGGAAC Chr10:79474870..79474889 62.32 55
upstream ENSMUSE00000312921 Chr10:79476057..79476163 AGGGAAGACATCCACCTTCC Chr10:79476086..79476105 60.31 55
upstream ENSMUSE00000312913 Chr10:79476364..79476505 TCTGATGCCATCTTCGACCT Chr10:79476416..79476435 60.77 50
upstream ENSMUSE00000312906 Chr10:79476591..79476725 GTACCTACAGCGGAGGCAAC Chr10:79476649..79476668 59.76 60
upstream ENSMUSE00000312896 Chr10:79476974..79477077 GTAGTGCTCACGTCGCACAG Chr10:79477058..79477077 60.68 60
upstream ENSMUSE00000312892 Chr10:79477213..79477305 GTCTGGGAAGCTCTCAGCAT Chr10:79477275..79477294 59.56 55
upstream ENSMUSE00000312886 Chr10:79477692..79477932 No primer for this exon

*** Putative Vector Insertion (Chr 10: 79477933 - 79478050) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000365113 Chr10:79478051..79478313 TCCTCTTCCCCTTGGTCTTT Chr10:79478091..79478110 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCTGAGGTGCCTCTAATCG Chr10:79477970..79477990 59.6 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAAGGGAAGAGCTGAGGTG Chr10:79477960..79477980 60.52 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035722