Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37143
Trapped Gene
Canx (ENSMUSG00000020368)
Vector Insertion
Chr 11: 50109838 - 50110559
Public Clones CMHD-GT_542B7-3 (cmhd) CMHD-GT_542B7-5S (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 97% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000103840 (Chr11:50110560..50110639 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000103840 (Chr11:50110560..50110639 -)
Downstram Exon
ENSMUSE00000366044 (Chr11:50107971..50109837 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000371309 Chr11:50138995..50139093 No primer for this exon
upstream ENSMUSE00000346916 Chr11:50125106..50125286 No primer for this exon
upstream ENSMUSE00000103860 Chr11:50124296..50124369 No primer for this exon
upstream ENSMUSE00000103866 Chr11:50123874..50123932 No primer for this exon
upstream ENSMUSE00000296570 Chr11:50122290..50122431 No primer for this exon
upstream ENSMUSE00000103859 Chr11:50121812..50121893 No primer for this exon
upstream ENSMUSE00000103857 Chr11:50120972..50121164 No primer for this exon
upstream ENSMUSE00000103855 Chr11:50117828..50118017 No primer for this exon
upstream ENSMUSE00000103853 Chr11:50115260..50115373 No primer for this exon
upstream ENSMUSE00000103851 Chr11:50114400..50114556 No primer for this exon
upstream ENSMUSE00000103856 Chr11:50112631..50112846 No primer for this exon
upstream ENSMUSE00000103848 Chr11:50111619..50111738 No primer for this exon
upstream ENSMUSE00000103868 Chr11:50110776..50110896 No primer for this exon
upstream ENSMUSE00000103840 Chr11:50110560..50110639 No primer for this exon

*** Putative Vector Insertion (Chr 11: 50109838 - 50110559) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000366044 Chr11:50107971..50109837 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGATGCTGAAGAAGATGGTGT Chr11:50110601..50110622 58.3 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020368