Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37144
Trapped Gene
Bcdo2 (ENSMUSG00000032066)
Vector Insertion
Chr 9: 50341191 - 50341625
Public Clones CMHD-GT_515B8-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 93% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000482177 (Chr9:50341256..50341624 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTTCGATGAGCACACTCTG Chr9:50341461..50341480 59.73 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000482177 (Chr9:50341256..50341624 -)
Downstram Exon
ENSMUSE00000711137 (Chr9:50341192..50341624 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTTCGATGAGCACACTCTG Chr9:50341461..50341480 59.73 55 CAGAGTGTGCTCATCGAAGC Chr9:50341439..50341458 59.73 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000715937 Chr9:50363126..50363286 TCCTGTGGCAGTGTACCATC Chr9:50363132..50363151 59.55 55
upstream ENSMUSE00000535226 Chr9:50358644..50358807 GTTGGACCTGGGAAGTTTGA Chr9:50358659..50358678 59.94 50
upstream ENSMUSE00000712969 Chr9:50358644..50358846 GTTGGACCTGGGAAGTTTGA Chr9:50358659..50358678 59.94 50
upstream ENSMUSE00000285932 Chr9:50353970..50354181 TTGCTTCACCAGTTCCGAAT Chr9:50354134..50354153 60.64 45
upstream ENSMUSE00000447697 Chr9:50353452..50353567 CCAACGTCAACTTTGTGCAG Chr9:50353533..50353552 60.34 50
upstream ENSMUSE00000475671 Chr9:50352562..50352664 ACCCAGATGGGACAGCATAC Chr9:50352590..50352609 59.81 55
upstream ENSMUSE00000476646 Chr9:50349148..50349276 ATGTTCCATTGCCTCCACTG Chr9:50349181..50349200 60.92 50
upstream ENSMUSE00000477620 Chr9:50348202..50348362 TTCTAAAATCCGGGGAAAGC Chr9:50348276..50348295 60.38 45
upstream ENSMUSE00000447691 Chr9:50346951..50347118 AGGACCAGGGCTGTATTGTG Chr9:50347038..50347057 59.99 55
upstream ENSMUSE00000285784 Chr9:50344336..50344473 CCCTCGAAGATTTGTCTTGC Chr9:50344428..50344447 59.81 50
upstream ENSMUSE00000216233 Chr9:50343583..50343765 CTTCTATGGCTGCGGTTTTC Chr9:50343639..50343658 59.85 50
upstream ENSMUSE00000216242 Chr9:50342715..50342825 CCAGGAGCAGATGAGGAAGA Chr9:50342755..50342774 60.49 55
upstream ENSMUSE00000482177 Chr9:50341256..50341624 GCTTCGATGAGCACACTCTG Chr9:50341461..50341480 59.73 55
upstream ENSMUSE00000711137 Chr9:50341192..50341624 GCTTCGATGAGCACACTCTG Chr9:50341461..50341480 59.73 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATGCCAAGAGCTTCACAGA Chr9:50341576..50341596 59.12 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATGCCAAGAGCTTCACAGA Chr9:50341576..50341596 59.12 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032066