Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37166
Trapped Gene
Gpnmb (ENSMUSG00000029816)
Vector Insertion
Chr 6: 48986792 - 48992765
Public Clones CMHD-GT_490D2-3 (cmhd) (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000193039 (Chr6:48986612..48986791 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGACACTGTGACTCCTGGTG Chr6:48986645..48986664 60.36 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000193039 (Chr6:48986612..48986791 +)
Downstram Exon
ENSMUSE00000193046 (Chr6:48992766..48992918 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGACACTGTGACTCCTGGTG Chr6:48986645..48986664 60.36 60 CAGCCACGTAATTGGTTGTG Chr6:48992838..48992857 60.03 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000193039 Chr6:48986612..48986791 CGACACTGTGACTCCTGGTG Chr6:48986645..48986664 60.36 60

*** Putative Vector Insertion (Chr 6: 48986792 - 48992765) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000193046 Chr6:48992766..48992918 CAGCCACGTAATTGGTTGTG Chr6:48992838..48992857 60.03 50
downstream ENSMUSE00000193040 Chr6:48993996..48994139 GAACACCAGGTTCACCACAA Chr6:48994081..48994100 59.42 50
downstream ENSMUSE00000193048 Chr6:48995304..48995477 CATCTTCCCAGTCACCATCA Chr6:48995378..48995397 59.47 50
downstream ENSMUSE00000193041 Chr6:48997293..48997451 CTGAACACCGACCCAGTTTT Chr6:48997328..48997347 60.01 50
downstream ENSMUSE00000193043 Chr6:48997735..48998100 AAGACGATGGGGAGGTCTCT Chr6:48997825..48997844 60.07 55
downstream ENSMUSE00000193044 Chr6:49000409..49000507 ATTCGGCAGTTTTCATTGGA Chr6:49000469..49000488 60.45 40
downstream ENSMUSE00000193047 Chr6:49001023..49001125 GCAGGTCACAGTGAAGTCCA Chr6:49001120..49001139 59.87 55
downstream ENSMUSE00000193042 Chr6:49001817..49002025 CAGTAGGTGCCAGACCCATT Chr6:49001957..49001976 59.99 55
downstream ENSMUSE00000193038 Chr6:49005620..49005713 TGCTCTCAGAGGGGAGTCTG Chr6:49005645..49005664 60.69 60
downstream ENSMUSE00000517463 Chr6:49006160..49006778 CTTGTCCTGGAGCAATGGAT Chr6:49006301..49006320 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTGTCTCGTGTGAACTCTGC Chr6:48989805..48989826 60.09 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGAATTTGTGTCTCGTGTGA Chr6:48989799..48989819 58.25 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029816