Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37167
Trapped Gene
Cog8 (ENSMUSG00000031916)
Vector Insertion
Chr 8: 109578130 - 109580160
Public Clones CMHD-GT_487E12-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000611318 (Chr8:109580161..109580583 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGCCAACTACAAGACGTTCA Chr8:109580267..109580286 59.9 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000611318 (Chr8:109580161..109580583 -)
Downstram Exon
ENSMUSE00000214631 (Chr8:109577922..109578129 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGCCAACTACAAGACGTTCA Chr8:109580267..109580286 59.9 50 TGTGTGCCGGTTTAGAGTCA Chr8:109578035..109578054 60.3 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000346388 Chr8:109580161..109580584 CGCCAACTACAAGACGTTCA Chr8:109580267..109580286 59.9 50
upstream ENSMUSE00000611318 Chr8:109580161..109580583 CGCCAACTACAAGACGTTCA Chr8:109580267..109580286 59.9 50

*** Putative Vector Insertion (Chr 8: 109578130 - 109580160) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000214631 Chr8:109577922..109578129 TGTGTGCCGGTTTAGAGTCA Chr8:109578035..109578054 60.3 50
downstream ENSMUSE00000214632 Chr8:109576113..109576940 CAAGGTCCCAGTCACATCCT Chr8:109576109..109576128 59.96 55
downstream ENSMUSE00000364072 Chr8:109574042..109574210 GGACTTGAAGACAGCGGTTC Chr8:109574053..109574072 59.85 55
downstream ENSMUSE00000414609 Chr8:109572683..109573030 GTCCAAGGTTTCCGTGCTTA Chr8:109572967..109572986 60.11 50
downstream ENSMUSE00000580190 Chr8:109572609..109573030 GTCCAAGGTTTCCGTGCTTA Chr8:109572967..109572986 60.11 50
downstream ENSMUSE00000335882 Chr8:109570195..109571171 ATGATTCGAGCTGTCCAACC Chr8:109571089..109571108 60.08 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTATCTGCCAGGACGCTAAT Chr8:109580105..109580126 59.74 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000031916