Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37177
Trapped Gene
Abhd9 (ENSMUSG00000037577)
Vector Insertion
Chr 17: 32325817 - 32325958
Public Clones CMHD-GT_483E2-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 34% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000311351 (Chr17:32325959..32326408 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGATATGCCGGAGTTTGTG Chr17:32326208..32326227 59.96 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000311351 (Chr17:32325959..32326408 -)
Downstram Exon
ENSMUSE00000311331 (Chr17:32325731..32325816 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGATATGCCGGAGTTTGTG Chr17:32326208..32326227 59.96 50 ATAGCATGAGTGGCCCATTG Chr17:32325734..32325753 60.88 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000311351 Chr17:32325959..32326408 AGGATATGCCGGAGTTTGTG Chr17:32326208..32326227 59.96 50

*** Putative Vector Insertion (Chr 17: 32325817 - 32325958) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000311331 Chr17:32325731..32325816 ATAGCATGAGTGGCCCATTG Chr17:32325734..32325753 60.88 50
downstream ENSMUSE00000311311 Chr17:32325356..32325513 CTACAGCCACGACATGGAAA Chr17:32325433..32325452 59.72 50
downstream ENSMUSE00000311280 Chr17:32325121..32325249 CCACAACCATACGCTCCACT Chr17:32325129..32325148 60.97 55
downstream ENSMUSE00000311257 Chr17:32322391..32322494 GAATATCTGGCCGATGTGGT Chr17:32322441..32322460 59.78 50
downstream ENSMUSE00000311238 Chr17:32322161..32322297 AGGCATCCAGGTTGTGAGAA Chr17:32322175..32322194 60.66 50
downstream ENSMUSE00000311220 Chr17:32320715..32322066 GGGGTGGAAAACAAGACAGA Chr17:32321578..32321597 59.94 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCGAGCATTGCTTTCTAACC Chr17:32325984..32326004 59.99 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCGAGCATTGCTTTCTAACC Chr17:32325984..32326004 59.99 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037577