Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37196
Trapped Gene
Lpar4 (ENSMUSG00000049929)
Vector Insertion
Chr X: 104116329 - 104119416
Public Clones CMHD-GT_514E2-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000459848 (ChrX:104115974..104116328 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGCGAGTTGCCAGTTTACA ChrX:104116245..104116264 59.91 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000459848 (ChrX:104115974..104116328 +)
Downstram Exon
ENSMUSE00000459617 (ChrX:104119417..104119518 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGCGAGTTGCCAGTTTACA ChrX:104116245..104116264 59.91 50 GGAGGCAGACGATCAGAGAG ChrX:104119454..104119473 60.1 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000459848 ChrX:104115974..104116328 GTGCGAGTTGCCAGTTTACA ChrX:104116245..104116264 59.91 50

*** Putative Vector Insertion (Chr X: 104116329 - 104119416) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000459617 ChrX:104119417..104119518 GGAGGCAGACGATCAGAGAG ChrX:104119454..104119473 60.1 60
downstream ENSMUSE00000352601 ChrX:104125469..104127771 CGATCGGAAGGGATAGACAA ChrX:104125991..104126010 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT ChrX:104116379..104116399 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGCTCGTGACTGGGAAAA ChrX:104119374..104119394 60.38 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049929