Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI372
Trapped Gene
Atp6v1d (ENSMUSG00000021114)
Vector Insertion
Chr 12: 79958332 - 79962405
Public Clones GC1107 (tigem) D103C02 (ggtc) IST14341F10 (tigm) IST14635H5 (tigm)
Private Clones OST369024 (lexicon) OST252724 (lexicon) OST194818 (lexicon) OST166272 (lexicon)
OST99373 (lexicon) OST67758 (lexicon) OST33759 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000346413 (Chr12:79962406..79962513 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000346413 (Chr12:79962406..79962513 -)
Downstram Exon
ENSMUSE00000114748 (Chr12:79958214..79958331 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000346413 Chr12:79962406..79962513 No primer for this exon

*** Putative Vector Insertion (Chr 12: 79958332 - 79962405) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000114748 Chr12:79958214..79958331 No primer for this exon
downstream ENSMUSE00000114752 Chr12:79953252..79953331 No primer for this exon
downstream ENSMUSE00000114750 Chr12:79951459..79951526 No primer for this exon
downstream ENSMUSE00000114749 Chr12:79950727..79950771 No primer for this exon
downstream ENSMUSE00000114753 Chr12:79949383..79949486 No primer for this exon
downstream ENSMUSE00000114751 Chr12:79948754..79948820 No primer for this exon
downstream ENSMUSE00000114754 Chr12:79946213..79946291 No primer for this exon
downstream ENSMUSE00000653839 Chr12:79943976..79944597 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCTTCCCTAATCGCCTTGC Chr12:79962342..79962362 60.55 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCGTGTTCAGGCACATCTT Chr12:79962357..79962377 60.58 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTAACCGGTTCTGGAGGTGT Chr12:79962494..79962514 58.92 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AACCGGTTCTGGAGGTGTTG Chr12:79959492..79959512 62.28 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021114