Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37211
Trapped Gene
Syp (ENSMUSG00000031144)
Vector Insertion
Chr X: 7230259 - 7230378
Public Clones CMHD-GT_499B2-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000707406 (ChrX:7228963..7230377 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGTGCCCTTCGGTATTGTT ChrX:7230293..7230312 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000707406 (ChrX:7228963..7230377 +)
Downstram Exon
ENSMUSE00000707408 (ChrX:7230260..7230377 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGTGCCCTTCGGTATTGTT ChrX:7230293..7230312 59.99 50 AACAATACCGAAGGGCACAG ChrX:7230315..7230334 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000707411 ChrX:7215597..7215854 CGCTTGCTCAAAAGATAGGC ChrX:7215684..7215703 60.12 50
upstream ENSMUSE00000431130 ChrX:7215812..7215854 ACATGGACGTGGTGAATCAG ChrX:7215835..7215854 59.39 50
upstream ENSMUSE00000707407 ChrX:7215837..7215854 No primer for this exon
upstream ENSMUSE00000243756 ChrX:7216984..7217049 No primer for this exon
upstream ENSMUSE00000206854 ChrX:7218223..7218347 GTGCCAACAAGACGGAGAGT ChrX:7218290..7218309 60.31 55
upstream ENSMUSE00000206853 ChrX:7221227..7221425 AGAACAACAAAGGGCCAATG ChrX:7221403..7221422 59.97 45
upstream ENSMUSE00000206855 ChrX:7222134..7222325 CAGTGTTCGCTTTCATGTGG ChrX:7222150..7222169 60.3 50
upstream ENSMUSE00000243718 ChrX:7225683..7226013 GTTGGCAACCTATGGTTCGT ChrX:7225713..7225732 59.86 50
upstream ENSMUSE00000707406 ChrX:7228963..7230377 CTGTGCCCTTCGGTATTGTT ChrX:7230293..7230312 59.99 50
upstream ENSMUSE00000707409 ChrX:7228963..7230126 GGAGTGGGTCGATGTGACTT ChrX:7229294..7229313 59.97 55
upstream ENSMUSE00000707410 ChrX:7228963..7230382 CTGTGCCCTTCGGTATTGTT ChrX:7230293..7230312 59.99 50

*** Putative Vector Insertion (Chr X: 7230259 - 7230378) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000707408 ChrX:7230260..7230377 AACAATACCGAAGGGCACAG ChrX:7230315..7230334 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTCCAGACCCCCTACTTTC ChrX:7230274..7230294 59.93 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031144