Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37215
Trapped Gene
Rps23 (ENSMUSG00000049517)
Vector Insertion
Chr 13: 91062805 - 91063191
Public Clones CMHD-GT_420D4-3 (cmhd) CMHD-GT_494H6-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000229067 (Chr13:91062770..91062804 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000229067 (Chr13:91062770..91062804 +)
Downstram Exon
ENSMUSE00000488780 (Chr13:91063192..91063351 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GTTCGGAGACCACGACACTT Chr13:91063216..91063235 60.16 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000229067 Chr13:91062770..91062804 No primer for this exon

*** Putative Vector Insertion (Chr 13: 91062805 - 91063191) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000488780 Chr13:91063192..91063351 GTTCGGAGACCACGACACTT Chr13:91063216..91063235 60.16 55
downstream ENSMUSE00000487946 Chr13:91063931..91064051 ATGAAGTTCAGGCAGCCATC Chr13:91064050..91064069 60.23 50
downstream ENSMUSE00000519512 Chr13:91064142..91064329 CACCTTAAAGCGGACTCCAG Chr13:91064225..91064244 59.87 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCTGCACCTCCTCTCTCTT Chr13:91062756..91062776 59.13 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCTGCACCTCCTCTCTCTT Chr13:91062756..91062776 59.13 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049517