Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37231
Trapped Gene
March7 (ENSMUSG00000026977)
Vector Insertion
Chr 2: 60070256 - 60070425
Public Clones CMHD-GT_476F8-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000566893 (Chr2:60070257..60070424 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCCCAGATCTTCATCAATGG Chr2:60070281..60070301 59.88 42.86 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000566893 (Chr2:60070257..60070424 +)
Downstram Exon
ENSMUSE00000692110 (Chr2:60070257..60070424 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCCCAGATCTTCATCAATGG Chr2:60070281..60070301 59.88 42.86 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662485 Chr2:60047987..60048141 No primer for this exon
upstream ENSMUSE00000662481 Chr2:60048130..60048141 No primer for this exon
upstream ENSMUSE00000662480 Chr2:60062827..60062927 AGGGCTGCATCATTTATTGG Chr2:60062830..60062849 59.92 45
upstream ENSMUSE00000711867 Chr2:60066975..60067139 CTGTTCAACCCTCTGGCTCT Chr2:60067024..60067043 59.45 55
upstream ENSMUSE00000719700 Chr2:60066975..60067139 CTGTTCAACCCTCTGGCTCT Chr2:60067024..60067043 59.45 55
upstream ENSMUSE00000721679 Chr2:60066975..60067139 CTGTTCAACCCTCTGGCTCT Chr2:60067024..60067043 59.45 55
upstream ENSMUSE00000566894 Chr2:60067741..60067936 GCCTGCCTGGTACAGTGAGT Chr2:60067776..60067795 60.33 60
upstream ENSMUSE00000692115 Chr2:60067741..60067936 GCCTGCCTGGTACAGTGAGT Chr2:60067776..60067795 60.33 60

*** Putative Vector Insertion (Chr 2: 60070256 - 60070425) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000566893 Chr2:60070257..60070424 No primer for this exon
downstream ENSMUSE00000692110 Chr2:60070257..60070424 No primer for this exon
downstream ENSMUSE00000566892 Chr2:60071956..60073054 AGAGGACGAGGAGGTTCCAT Chr2:60072446..60072465 60.07 55
downstream ENSMUSE00000692107 Chr2:60071956..60073054 AGAGGACGAGGAGGTTCCAT Chr2:60072446..60072465 60.07 55
downstream ENSMUSE00000566891 Chr2:60074811..60074983 CATTTGCACGGCTCTATCAA Chr2:60074918..60074937 59.83 45
downstream ENSMUSE00000566890 Chr2:60079000..60079109 No primer for this exon
downstream ENSMUSE00000566889 Chr2:60081614..60081727 GACACGAGTGCTTGGTTCAA Chr2:60081727..60081746 59.88 50
downstream ENSMUSE00000662483 Chr2:60083269..60083317 CCTGAAGAGTTCTTGCAAGGTT Chr2:60083297..60083318 59.92 45.46
downstream ENSMUSE00000692106 Chr2:60085545..60085569 No primer for this exon
downstream ENSMUSE00000662479 Chr2:60085947..60086030 No primer for this exon
downstream ENSMUSE00000662482 Chr2:60085947..60086014 No primer for this exon
downstream ENSMUSE00000692105 Chr2:60085947..60086014 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGTACTTAATCGCCTTGCAG Chr2:60070300..60070321 60.27 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000026977