Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37244
Trapped Gene
Mapkapk3 (ENSMUSG00000032577)
Vector Insertion
Chr 9: 107187473 - 107191450
Public Clones CMHD-GT_473C11-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 28% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000458704 (Chr9:107191451..107191502 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000458704 (Chr9:107191451..107191502 -)
Downstram Exon
ENSMUSE00000530178 (Chr9:107187005..107187472 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCAGGACATTCAAGCCCAAT Chr9:107187226..107187245 60.46 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000380879 Chr9:107191856..107192208 CTGCACCATGATTTTCGTGT Chr9:107192005..107192024 59.57 45
upstream ENSMUSE00000458716 Chr9:107191505..107191675 GCGGTGACTGATGACTACCA Chr9:107191539..107191558 59.71 55
upstream ENSMUSE00000458704 Chr9:107191451..107191502 No primer for this exon
upstream ENSMUSE00000494972 Chr9:107191451..107191727 GGTGTGAACGGCAAGGTACT Chr9:107191494..107191513 60.03 55
upstream ENSMUSE00000709204 Chr9:107191451..107191727 GGTGTGAACGGCAAGGTACT Chr9:107191494..107191513 60.03 55

*** Putative Vector Insertion (Chr 9: 107187473 - 107191450) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000530178 Chr9:107187005..107187472 TCAGGACATTCAAGCCCAAT Chr9:107187226..107187245 60.46 45
downstream ENSMUSE00000220977 Chr9:107165956..107166095 CTCATACACGTCCAGGATGC Chr9:107165978..107165997 59.12 55
downstream ENSMUSE00000220975 Chr9:107164754..107164818 TGAATCCTGCTGAACAGCTC Chr9:107164764..107164783 59.12 50
downstream ENSMUSE00000220974 Chr9:107164209..107164288 CCAATGTCCCGCATTATCTC Chr9:107164239..107164258 60.3 50
downstream ENSMUSE00000220972 Chr9:107162376..107162499 CAAAGCCAAAATCGGTGAGT Chr9:107162411..107162430 60.11 45
downstream ENSMUSE00000220971 Chr9:107161145..107161220 No primer for this exon
downstream ENSMUSE00000220978 Chr9:107160661..107160785 TATACTGGCCCAAGCGAATC Chr9:107160678..107160697 60.06 50
downstream ENSMUSE00000220970 Chr9:107159746..107159831 TGTGGGATCTGTCTTCAGGA Chr9:107159769..107159788 59.18 50
downstream ENSMUSE00000220979 Chr9:107159393..107159473 GCACTCGGGCTGTGTAGAGT Chr9:107159406..107159425 60.48 60
downstream ENSMUSE00000691682 Chr9:107159393..107159473 GCACTCGGGCTGTGTAGAGT Chr9:107159406..107159425 60.48 60
downstream ENSMUSE00000338130 Chr9:107157258..107158666 GGGTATATCCGCCACAACAC Chr9:107158177..107158196 60.08 55
downstream ENSMUSE00000691681 Chr9:107157258..107158666 GGGTATATCCGCCACAACAC Chr9:107158177..107158196 60.08 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTGTGTAGGACCACAGCAA Chr9:107188478..107188498 59.9 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTGTGTAGGACCACAGCAA Chr9:107188478..107188498 59.9 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032577