Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37255
Trapped Gene
Crb2 (ENSMUSG00000035403)
Vector Insertion
Chr 2: 37642378 - 37642783
Public Clones CMHD-GT_484D7-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 20% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000254517 (Chr2:37642238..37642377 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000254517 (Chr2:37642238..37642377 +)
Downstram Exon
ENSMUSE00000254510 (Chr2:37642784..37642969 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GTACAAGGTCGGGTCAGAGC Chr2:37642887..37642906 59.73 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000693617 Chr2:37631861..37631966 GGGGCCCTAGACGAGATATT Chr2:37631886..37631905 59.4 55
upstream ENSMUSE00000254480 Chr2:37638720..37639043 TCCTAACAGCTTCCGTTGCT Chr2:37638889..37638908 60.01 50
upstream ENSMUSE00000254526 Chr2:37641959..37642154 TGTGTCACGACCTGGTCAAC Chr2:37642133..37642152 60.64 55
upstream ENSMUSE00000254517 Chr2:37642238..37642377 No primer for this exon

*** Putative Vector Insertion (Chr 2: 37642378 - 37642783) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000254510 Chr2:37642784..37642969 GTACAAGGTCGGGTCAGAGC Chr2:37642887..37642906 59.73 60
downstream ENSMUSE00000254506 Chr2:37643179..37643292 ATCCATCCTGGCAGTAGCAC Chr2:37643289..37643308 60.1 55
downstream ENSMUSE00000254500 Chr2:37645648..37646520 CAAGCAGGGTGGTACGAAAT Chr2:37646007..37646026 59.99 50
downstream ENSMUSE00000254466 Chr2:37646606..37647111 TGAATCATTGGCAAACTGGA Chr2:37646754..37646773 60.05 40
downstream ENSMUSE00000254457 Chr2:37647574..37647739 TCTGGAACCTCCTCACAGGT Chr2:37647731..37647750 59.68 55
downstream ENSMUSE00000254451 Chr2:37648619..37649387 CCGTGAAGTTCTCAGCCAGT Chr2:37649035..37649054 60.44 55
downstream ENSMUSE00000254441 Chr2:37650050..37650166 TCCTTGCATGTGGAGTTGAG Chr2:37650100..37650119 59.83 50
downstream ENSMUSE00000334908 Chr2:37650895..37651021 GCTTCACAGGGTTTGTCGAG Chr2:37650927..37650946 60.83 55
downstream ENSMUSE00000398399 Chr2:37651968..37654619 ATTGGTGACACTGACGTGGA Chr2:37653699..37653718 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr2:37642429..37642449 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000035403